ID: 1074864522

View in Genome Browser
Species Human (GRCh38)
Location 10:117537123-117537145
Sequence CCATCCATCCCGGGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864522_1074864529 -3 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864522_1074864530 2 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864522_1074864534 25 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864522_1074864532 3 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864532 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864522 Original CRISPR CCATCCATCCCGGGGCAGCC TGG (reversed) Intergenic