ID: 1074864523

View in Genome Browser
Species Human (GRCh38)
Location 10:117537123-117537145
Sequence CCAGGCTGCCCCGGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864507_1074864523 23 Left 1074864507 10:117537077-117537099 CCAGTGAAGCCCAAGCGGATTCC No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864512_1074864523 2 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864514_1074864523 -4 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864517_1074864523 -6 Left 1074864517 10:117537106-117537128 CCACATCACCGGAGGAGCCAGGC No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864509_1074864523 14 Left 1074864509 10:117537086-117537108 CCCAAGCGGATTCCACGGCCCCA No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864515_1074864523 -5 Left 1074864515 10:117537105-117537127 CCCACATCACCGGAGGAGCCAGG No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864510_1074864523 13 Left 1074864510 10:117537087-117537109 CCAAGCGGATTCCACGGCCCCAC No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864523 Original CRISPR CCAGGCTGCCCCGGGATGGA TGG Intergenic