ID: 1074864526

View in Genome Browser
Species Human (GRCh38)
Location 10:117537131-117537153
Sequence CGCGGACCCCATCCATCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864526_1074864532 -5 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864532 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data
1074864526_1074864534 17 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864526_1074864530 -6 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864526_1074864535 26 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864526 Original CRISPR CGCGGACCCCATCCATCCCG GGG (reversed) Intergenic
No off target data available for this crispr