ID: 1074864529

View in Genome Browser
Species Human (GRCh38)
Location 10:117537143-117537165
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864514_1074864529 16 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864512_1074864529 22 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864517_1074864529 14 Left 1074864517 10:117537106-117537128 CCACATCACCGGAGGAGCCAGGC No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864522_1074864529 -3 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864515_1074864529 15 Left 1074864515 10:117537105-117537127 CCCACATCACCGGAGGAGCCAGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864518_1074864529 6 Left 1074864518 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864529 Original CRISPR TGGGGTCCGCGCGCTCCGAG AGG Intergenic