ID: 1074864530

View in Genome Browser
Species Human (GRCh38)
Location 10:117537148-117537170
Sequence TCCGCGCGCTCCGAGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864514_1074864530 21 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864522_1074864530 2 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864515_1074864530 20 Left 1074864515 10:117537105-117537127 CCCACATCACCGGAGGAGCCAGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864526_1074864530 -6 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864512_1074864530 27 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864527_1074864530 -7 Left 1074864527 10:117537132-117537154 CCCGGGATGGATGGGGTCCGCGC No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864517_1074864530 19 Left 1074864517 10:117537106-117537128 CCACATCACCGGAGGAGCCAGGC No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864528_1074864530 -8 Left 1074864528 10:117537133-117537155 CCGGGATGGATGGGGTCCGCGCG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864518_1074864530 11 Left 1074864518 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864530 Original CRISPR TCCGCGCGCTCCGAGAGGAA TGG Intergenic