ID: 1074864534

View in Genome Browser
Species Human (GRCh38)
Location 10:117537171-117537193
Sequence GCTAGTCAATGTGCGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864522_1074864534 25 Left 1074864522 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864528_1074864534 15 Left 1074864528 10:117537133-117537155 CCGGGATGGATGGGGTCCGCGCG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864527_1074864534 16 Left 1074864527 10:117537132-117537154 CCCGGGATGGATGGGGTCCGCGC No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864526_1074864534 17 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864533_1074864534 -10 Left 1074864533 10:117537158-117537180 CCGAGAGGAATGGGCTAGTCAAT No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data
1074864531_1074864534 -1 Left 1074864531 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data
Right 1074864534 10:117537171-117537193 GCTAGTCAATGTGCGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864534 Original CRISPR GCTAGTCAATGTGCGCTGCT AGG Intergenic