ID: 1074864535

View in Genome Browser
Species Human (GRCh38)
Location 10:117537180-117537202
Sequence TGTGCGCTGCTAGGAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864533_1074864535 -1 Left 1074864533 10:117537158-117537180 CCGAGAGGAATGGGCTAGTCAAT No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data
1074864528_1074864535 24 Left 1074864528 10:117537133-117537155 CCGGGATGGATGGGGTCCGCGCG No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data
1074864526_1074864535 26 Left 1074864526 10:117537131-117537153 CCCCGGGATGGATGGGGTCCGCG No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data
1074864527_1074864535 25 Left 1074864527 10:117537132-117537154 CCCGGGATGGATGGGGTCCGCGC No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data
1074864531_1074864535 8 Left 1074864531 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data
Right 1074864535 10:117537180-117537202 TGTGCGCTGCTAGGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864535 Original CRISPR TGTGCGCTGCTAGGAGTGTG TGG Intergenic