ID: 1074864536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:117537211-117537233 |
| Sequence | CGCCACCCCTGCCAAAACCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074864533_1074864536 | 30 | Left | 1074864533 | 10:117537158-117537180 | CCGAGAGGAATGGGCTAGTCAAT | No data | ||
| Right | 1074864536 | 10:117537211-117537233 | CGCCACCCCTGCCAAAACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074864536 | Original CRISPR | CGCCACCCCTGCCAAAACCA AGG | Intergenic | ||