ID: 1074865025

View in Genome Browser
Species Human (GRCh38)
Location 10:117539904-117539926
Sequence ACAGTCCCACTTCAGTCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074865025_1074865032 22 Left 1074865025 10:117539904-117539926 CCGACTGACTGAAGTGGGACTGT No data
Right 1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG No data
1074865025_1074865031 21 Left 1074865025 10:117539904-117539926 CCGACTGACTGAAGTGGGACTGT No data
Right 1074865031 10:117539948-117539970 GCAGCCAGATGTCCCTGCCTGGG No data
1074865025_1074865034 29 Left 1074865025 10:117539904-117539926 CCGACTGACTGAAGTGGGACTGT No data
Right 1074865034 10:117539956-117539978 ATGTCCCTGCCTGGGGCAGAAGG No data
1074865025_1074865030 20 Left 1074865025 10:117539904-117539926 CCGACTGACTGAAGTGGGACTGT No data
Right 1074865030 10:117539947-117539969 TGCAGCCAGATGTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074865025 Original CRISPR ACAGTCCCACTTCAGTCAGT CGG (reversed) Intergenic
No off target data available for this crispr