ID: 1074865032

View in Genome Browser
Species Human (GRCh38)
Location 10:117539949-117539971
Sequence CAGCCAGATGTCCCTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074865025_1074865032 22 Left 1074865025 10:117539904-117539926 CCGACTGACTGAAGTGGGACTGT No data
Right 1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074865032 Original CRISPR CAGCCAGATGTCCCTGCCTG GGG Intergenic
No off target data available for this crispr