ID: 1074865430

View in Genome Browser
Species Human (GRCh38)
Location 10:117542121-117542143
Sequence CGGCCCCGCGTCGGGAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074865430_1074865435 -4 Left 1074865430 10:117542121-117542143 CCAGTTCTCCCGACGCGGGGCCG No data
Right 1074865435 10:117542140-117542162 GCCGCGTAAGGCAGCAGCGGCGG No data
1074865430_1074865437 5 Left 1074865430 10:117542121-117542143 CCAGTTCTCCCGACGCGGGGCCG No data
Right 1074865437 10:117542149-117542171 GGCAGCAGCGGCGGAGCGCTAGG No data
1074865430_1074865434 -7 Left 1074865430 10:117542121-117542143 CCAGTTCTCCCGACGCGGGGCCG No data
Right 1074865434 10:117542137-117542159 GGGGCCGCGTAAGGCAGCAGCGG No data
1074865430_1074865438 12 Left 1074865430 10:117542121-117542143 CCAGTTCTCCCGACGCGGGGCCG No data
Right 1074865438 10:117542156-117542178 GCGGCGGAGCGCTAGGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074865430 Original CRISPR CGGCCCCGCGTCGGGAGAAC TGG (reversed) Intergenic
No off target data available for this crispr