ID: 1074865762

View in Genome Browser
Species Human (GRCh38)
Location 10:117543560-117543582
Sequence TGGCGAGTGCGAGGAGGGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 598}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074865762_1074865773 5 Left 1074865762 10:117543560-117543582 CCCTACCCTCCTCGCACTCGCCA 0: 1
1: 0
2: 2
3: 58
4: 598
Right 1074865773 10:117543588-117543610 CCTATTCGCCTCGCAGCAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1074865762_1074865775 28 Left 1074865762 10:117543560-117543582 CCCTACCCTCCTCGCACTCGCCA 0: 1
1: 0
2: 2
3: 58
4: 598
Right 1074865775 10:117543611-117543633 ATCCGTCCACCTTCTACCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 93
1074865762_1074865771 4 Left 1074865762 10:117543560-117543582 CCCTACCCTCCTCGCACTCGCCA 0: 1
1: 0
2: 2
3: 58
4: 598
Right 1074865771 10:117543587-117543609 CCCTATTCGCCTCGCAGCAGCGG 0: 1
1: 0
2: 1
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074865762 Original CRISPR TGGCGAGTGCGAGGAGGGTA GGG (reversed) Exonic
901323973 1:8356159-8356181 GGGAGAGTGCCAGGCGGGTAGGG + Exonic
903577338 1:24346940-24346962 TGGGGAGTGGGAGAAGGGTGGGG + Intronic
904269524 1:29340610-29340632 TGGAGGCTGGGAGGAGGGTAAGG - Intergenic
904849669 1:33447848-33447870 TGGAGGGTGGGAGGAGGATAGGG - Intergenic
905355755 1:37383032-37383054 TGGCTGCTGTGAGGAGGGTAAGG - Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
906557722 1:46727821-46727843 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
906585308 1:46971067-46971089 TGGAGAGTGGGAGGGGGTTAAGG - Intergenic
906908781 1:49924294-49924316 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
906997547 1:50813071-50813093 TGGCGGGTGGGAGGAAGGTGAGG + Intronic
908187921 1:61670383-61670405 TGGGGAGGGAGAGGAGGGCAAGG + Intergenic
908401079 1:63773820-63773842 TGGCGAGTTTGAGGAGTGTGGGG + Intergenic
908434927 1:64096375-64096397 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
908477739 1:64505784-64505806 TGGCGACCGGGAGGAGGGTCAGG - Intronic
909305013 1:74062836-74062858 TGGTGGGTGTGAGGAGGGTGAGG + Intronic
909875024 1:80791004-80791026 TGGAGGTTGAGAGGAGGGTAAGG + Intergenic
910096936 1:83533934-83533956 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
910180917 1:84481570-84481592 TGGGGAGTGGGAGGACGGTGAGG + Intronic
910297487 1:85664625-85664647 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
911429215 1:97762010-97762032 TGGACAGTGGGAGGAGGGTGAGG + Intronic
912155698 1:106916162-106916184 TGGAGATTGGGAGGAGGGAAAGG + Intergenic
912702167 1:111886499-111886521 TGTCCTGTGCGAGGAGGGTTAGG + Intronic
915867570 1:159520353-159520375 AGGAGGGTGGGAGGAGGGTAAGG - Intergenic
916949536 1:169765239-169765261 TGGGGAGTGAGAAAAGGGTAAGG + Intronic
917007710 1:170433566-170433588 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
917051078 1:170924227-170924249 TGGAGAGTGGGAGGAGGGAAAGG + Intergenic
917184916 1:172342611-172342633 TGGAGAGTGGGAGGAGAGAAAGG + Intronic
917253073 1:173083613-173083635 TAGAGAGTAGGAGGAGGGTAAGG + Intergenic
917258236 1:173139626-173139648 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
917655878 1:177124914-177124936 TGGCGTGTGAGAGGAGAGCACGG - Intronic
918100601 1:181369940-181369962 TGGAGCGTGGGAGGAGGGTGAGG - Intergenic
918100641 1:181370416-181370438 AGGAGGGTGGGAGGAGGGTAAGG - Intergenic
918760000 1:188391970-188391992 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
918928272 1:190816081-190816103 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
919600290 1:199614050-199614072 TGGAGAGTGAGAGGAGGGAGAGG - Intergenic
919686724 1:200489714-200489736 TGGAGCGTGAGAGGAGGGTGAGG - Intergenic
920542466 1:206789721-206789743 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
921372261 1:214436248-214436270 TGGAGGGTGAGAGGAGGGTAAGG + Intronic
922207147 1:223458037-223458059 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
922527914 1:226320269-226320291 TGGAGAGTGGGAGGAGGGAGCGG + Intergenic
922618828 1:226978538-226978560 TGGGGGGTGTGTGGAGGGTAAGG - Intronic
922621503 1:226992013-226992035 TGGGGAGAGTGAGGAGGGTGGGG + Exonic
922621509 1:226992031-226992053 TGGGGAGAGTGAGGAGGGTGGGG + Exonic
922776922 1:228219106-228219128 TGGCATGTGCCAGGAGGGCAGGG - Intronic
922868271 1:228879469-228879491 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
923220049 1:231884643-231884665 TGGAGGGTGGGAGGAGGGTAAGG + Intronic
923376588 1:233369863-233369885 TGACGAGTGAGAGGAGAATAGGG + Intronic
923822039 1:237455422-237455444 TGGAGGGTGGGAGGAGGGCAAGG + Intronic
924587466 1:245372505-245372527 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1063287439 10:4705763-4705785 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1063448043 10:6132467-6132489 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1063453834 10:6169359-6169381 TGGCGGCTGTGAGCAGGGTAGGG + Intronic
1063468097 10:6261533-6261555 AGGAGAGTGGGAGGAGGGAAAGG + Intergenic
1063732050 10:8708800-8708822 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1064241630 10:13635034-13635056 TGGCGGGTGGGAGGAGGGAGAGG - Intronic
1064378278 10:14816700-14816722 GGGAGAGTGGGAGGAAGGTAAGG - Intergenic
1064437105 10:15320112-15320134 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1065221583 10:23501426-23501448 TGGAGAGTGGGAGGAGGGAAAGG - Intergenic
1065368361 10:24956276-24956298 TGGAGGGCGGGAGGAGGGTAAGG - Intergenic
1065652975 10:27913268-27913290 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1066097623 10:32087286-32087308 AGGAGAGTGGGAGGAGGGCAAGG - Intergenic
1066218098 10:33308215-33308237 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1068248515 10:54405538-54405560 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1068832602 10:61514525-61514547 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1069934152 10:71903733-71903755 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1070871131 10:79754462-79754484 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1071157558 10:82708449-82708471 TGGCAAGTGAGAGGAGAGTGAGG - Intronic
1071657179 10:87461282-87461304 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1071929700 10:90454641-90454663 TGGAGAGTGGGAGGAGAGTGAGG - Intergenic
1073061210 10:100734983-100735005 TGGCGAGGGCGAGGGGGAAAGGG - Intergenic
1073565072 10:104527988-104528010 TGGCAGGTGCTAGGAGGGCAAGG + Intergenic
1073832294 10:107399137-107399159 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1073960561 10:108922048-108922070 TGGGGAGTGGGAGGAGGGAGAGG - Intergenic
1073991705 10:109268816-109268838 TGAGGAGTGGGAGGATGGTAGGG + Intergenic
1074042554 10:109806131-109806153 TGGAGAGTAGGAGGAGGGTGAGG + Intergenic
1074459573 10:113624963-113624985 TGGCAAGGGCGAGGTGGGCAGGG + Intronic
1074546708 10:114406835-114406857 TGGAGGGTGAGAGGAGAGTAGGG + Intergenic
1074648695 10:115493252-115493274 TGGAGAGTAAGAGGAGGGTGAGG - Intronic
1074865762 10:117543560-117543582 TGGCGAGTGCGAGGAGGGTAGGG - Exonic
1075543426 10:123335289-123335311 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1075707279 10:124509014-124509036 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1075834142 10:125438928-125438950 TGGAGTGTGGGAGGAGAGTAAGG + Intergenic
1076844881 10:133065246-133065268 TGGCCAGCCCGAGGAGGGGAGGG - Intergenic
1077984319 11:7335453-7335475 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
1078198514 11:9157469-9157491 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1078385738 11:10890928-10890950 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1079495070 11:21033373-21033395 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
1080147832 11:29009086-29009108 TGGTGAGTGGGAGGAGGGTGAGG - Intergenic
1080414859 11:32060208-32060230 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1080519211 11:33052095-33052117 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1081060383 11:38467617-38467639 TGGAGAGTGGGAGGAGGGTAAGG + Intergenic
1081530053 11:43952210-43952232 TGGAGGGTGGGAGGAGAGTAAGG - Intergenic
1081875243 11:46404071-46404093 TGGCGTGTGCCAGGAGGCTGAGG + Intronic
1082026845 11:47578811-47578833 AGGCGGGTGAGAGGAGGGGAGGG - Intronic
1082716210 11:56617398-56617420 TGAAGTGTGGGAGGAGGGTAAGG - Intergenic
1082859330 11:57839080-57839102 TGGAGAGTGAGAGGAGGGTGAGG + Intergenic
1083213895 11:61206644-61206666 TGGGGAGTGAGAGTGGGGTAGGG - Intronic
1083216779 11:61225473-61225495 TGGGGAGTGAGAGTGGGGTAGGG - Intronic
1083219661 11:61244299-61244321 TGGGGAGTGAGAGTGGGGTAGGG - Intronic
1083495255 11:63046578-63046600 TGGAGAGTGGGAGGAAGGTGAGG + Intergenic
1083520796 11:63310706-63310728 TGGTGATTGGGAGGAGGGAAAGG + Intronic
1084599911 11:70138918-70138940 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1084684937 11:70687902-70687924 TGGCGAGTGGGTGGATGGTGGGG - Intronic
1084841490 11:71854542-71854564 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1084904423 11:72334844-72334866 TGGAGAGGGAGAGGAGGGGAGGG - Intronic
1085586015 11:77706810-77706832 TGGAGGGTGGGAGGAGGGTCAGG - Intronic
1085893958 11:80614654-80614676 TGGAGGGTGCGAGGAGGGTAAGG - Intergenic
1086372254 11:86166676-86166698 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1086447369 11:86882344-86882366 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1087756931 11:102064216-102064238 TGGGGAGTGGAAGGAGGGTTTGG - Intronic
1088042158 11:105400189-105400211 AGGAGAATGCGAGGAGGGCAAGG - Intergenic
1088238434 11:107749832-107749854 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1088365212 11:109033118-109033140 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1089884894 11:121810760-121810782 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1090727687 11:129542492-129542514 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1092529136 12:9329850-9329872 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1094226015 12:28046979-28047001 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1096690919 12:53321319-53321341 TGGCCAGGGCGAGGAGGGAGGGG - Intronic
1097505879 12:60469233-60469255 TGGAGGGTGAGAGGAGGGAAAGG - Intergenic
1097974532 12:65670429-65670451 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1098229487 12:68358591-68358613 TGGGGAGTGTGGAGAGGGTAAGG + Intergenic
1098568723 12:71964923-71964945 TGGAGGGTGAGAGGAGGGTGAGG - Intronic
1098663621 12:73131671-73131693 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1098801962 12:74971835-74971857 TGGAGAGTGGGAGGAGGTTGAGG + Intergenic
1099200931 12:79675738-79675760 TGGAGGGTGGGAGAAGGGTAAGG + Intronic
1099305805 12:80954091-80954113 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1099404172 12:82239658-82239680 TGGAGGGTGAGAGGAAGGTAAGG - Intronic
1099617171 12:84950807-84950829 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
1099833937 12:87882593-87882615 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1099843896 12:88004886-88004908 TGGAGGGTGAGAGGAGGGTGAGG + Intronic
1099991659 12:89728887-89728909 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1101327555 12:103729203-103729225 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1101883609 12:108642495-108642517 TGGCGAGTGTCAGGAGGGCTGGG - Intergenic
1103079681 12:118013780-118013802 TGGAGAGTGTTAGGAGGGAAGGG + Intronic
1103389574 12:120562134-120562156 TGGAGAGTGGGAGGAGGGAGGGG - Intronic
1104155780 12:126130384-126130406 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1104401357 12:128479213-128479235 TGGAGGGTGCGAGGAGGGAGAGG + Intronic
1105056502 12:133104935-133104957 TGGAATGTGGGAGGAGGGTAAGG - Intronic
1105446219 13:20459700-20459722 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1105806607 13:23955170-23955192 TGGCAAGTGAGAGGAGGAAAGGG + Intergenic
1106318425 13:28616041-28616063 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1106604639 13:31216587-31216609 TGGCGGGTGGGAGGAGAGCAAGG - Intronic
1106742023 13:32654672-32654694 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1107573440 13:41688827-41688849 TGGAGAGTGGGAGGAGGGTGAGG + Intronic
1107777092 13:43856194-43856216 TGGAGGGTGAGAGGAGGGAAAGG + Intronic
1108129545 13:47283020-47283042 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1108467291 13:50729167-50729189 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1109175580 13:59151345-59151367 TGGAGAGTGTGAGGAGGGAGGGG - Intergenic
1109254941 13:60068634-60068656 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1109890901 13:68613247-68613269 TGGAGTGTGGGAGGAGGGTGAGG - Intergenic
1110030373 13:70603923-70603945 TGGAGGGTGAGAGGAGGGAAAGG + Intergenic
1110174470 13:72539135-72539157 TGGGGAGTGAATGGAGGGTAAGG - Intergenic
1110251653 13:73387241-73387263 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
1112157042 13:96829467-96829489 TGGGGGGTGCGAGGAGGGAGAGG - Intronic
1112897907 13:104323753-104323775 TGGTGCGTGAGTGGAGGGTAAGG - Intergenic
1112912582 13:104506303-104506325 TGGAGGGTGGGAGGAGGGTGGGG + Intergenic
1112958431 13:105090855-105090877 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1113206024 13:107917023-107917045 TGGAGAGTAGGAGGAGGGTGAGG - Intergenic
1113823355 13:113231439-113231461 TGGGGAGTGGGAGGTGGGGAGGG + Intronic
1115021044 14:28682218-28682240 TGGAGAGTGGGAGAAGGGTGAGG - Intergenic
1115357772 14:32467051-32467073 TGAAGAGTGGGAGGAGGGTACGG + Intronic
1115713628 14:36077404-36077426 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1116130618 14:40852356-40852378 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1116319726 14:43446350-43446372 TGGTGGGTGGGAGGAGGGTTGGG - Intergenic
1116355162 14:43919240-43919262 TGGAGAGTGAGAGGAGGGAGAGG - Intergenic
1116377252 14:44218612-44218634 TGGAGAGTGAGAGGCGGGTGAGG + Intergenic
1116810601 14:49536407-49536429 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1118665914 14:68069423-68069445 TGGAGAGTGGGAGGATGGTGAGG - Intronic
1120336102 14:83157070-83157092 TGAAGAGTGGGAGGAGGGTGAGG + Intergenic
1120517858 14:85491425-85491447 TGGAGAGTGGGAGGAGGGAAAGG + Intergenic
1120960457 14:90120052-90120074 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1121798030 14:96751887-96751909 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1123769657 15:23516080-23516102 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1124130505 15:26980927-26980949 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1124344812 15:28915097-28915119 TGGTGTGTGTGAGGTGGGTATGG - Intronic
1125337873 15:38645726-38645748 TGGGGAGAGAGAGGAGGGAAAGG + Intergenic
1125889842 15:43257538-43257560 TGGAGGGTGGGAGGAAGGTAAGG + Intronic
1126233925 15:46359747-46359769 TGGAGAGTGGGAGGAGGGAAAGG + Intergenic
1126655154 15:50969145-50969167 TGGAGGGTGAGAGGAGGGTGAGG - Intronic
1126993337 15:54409516-54409538 TGGAGGGTGGGAGGAGAGTACGG - Intronic
1127124883 15:55802272-55802294 TGACAAGTGGGAGGAGGGCAAGG - Intergenic
1127282123 15:57501598-57501620 TGGGGAGCAGGAGGAGGGTAAGG + Intronic
1129238394 15:74237372-74237394 TTGCTAGTGAGAGGAAGGTAAGG - Intronic
1129438702 15:75563071-75563093 TGGAGAGTGGGAGGAGGGCGAGG - Intronic
1129979595 15:79855654-79855676 TGGGGAGTGGGAGAAGGGAAAGG - Intronic
1130189456 15:81719090-81719112 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1130820592 15:87491192-87491214 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1131838658 15:96414750-96414772 TGAGGAGTGTGAGGAGGGGATGG + Intergenic
1132144635 15:99421765-99421787 TGGAGAGTGGGAGGAGGGAAAGG - Intergenic
1132186407 15:99805834-99805856 AGGCGAGTGTGAGGAATGTAGGG + Intergenic
1132429271 15:101746876-101746898 AGGCGAGTGTGAGGAATGTAGGG - Intergenic
1133087124 16:3373540-3373562 TAGAGAGTGGGAGGAGGGTGAGG - Intronic
1133535876 16:6701949-6701971 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1133733215 16:8593716-8593738 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1134205684 16:12236301-12236323 TGGGGAGTCTGAGGAGGGCATGG + Intronic
1135533004 16:23270629-23270651 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1136912997 16:34159554-34159576 TGGTGAGAGCCCGGAGGGTATGG + Intergenic
1137357681 16:47782368-47782390 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1137826920 16:51505927-51505949 GGGAGAGTGGGAGGAGGGCAAGG - Intergenic
1137944875 16:52724215-52724237 TGGAGGGTGGGAGGAGGGTAAGG - Intergenic
1137971602 16:52990863-52990885 TGGAGAGTGGGAGGAGAGAAAGG + Intergenic
1138058072 16:53857222-53857244 TGGAAGGTGGGAGGAGGGTAAGG - Intronic
1138065561 16:53937602-53937624 TCGTGAGTGAGAGGAGGGTGGGG + Intronic
1138531533 16:57637096-57637118 TGGCGACTGCAAGGAAGGGATGG + Intronic
1139255110 16:65533664-65533686 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1139305021 16:65977824-65977846 TGGAGGGTGGGAGGAGGGTAAGG + Intergenic
1140170384 16:72598617-72598639 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1140170423 16:72598769-72598791 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1140170472 16:72598981-72599003 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1140170480 16:72599013-72599035 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1140255927 16:73336373-73336395 TGGGGGGTGGGAGGAGGGTAAGG - Intergenic
1140591816 16:76362754-76362776 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1140647762 16:77051745-77051767 GGAAGAGTGGGAGGAGGGTAGGG + Intergenic
1140655138 16:77132363-77132385 TGGGGAGGGGGAGGAGGGAAAGG - Intergenic
1141014179 16:80432600-80432622 TGGTGAGAGGGAGGTGGGTATGG + Intergenic
1141167424 16:81669710-81669732 AGGTGAGTGTGAGGTGGGTATGG - Intronic
1141667771 16:85474699-85474721 TGGGGAGAGGGAGGAGGGGAAGG - Intergenic
1141721729 16:85759745-85759767 TGGTGAGTGTGAGGCGGGTGTGG + Intergenic
1141805603 16:86339425-86339447 TGGCGGGTAGGAGGAGGGTGAGG - Intergenic
1141881712 16:86864570-86864592 TGGAGGGAGGGAGGAGGGTAAGG - Intergenic
1141914085 16:87082119-87082141 TGGTGCTTGCGATGAGGGTAGGG + Intergenic
1142004857 16:87684863-87684885 TGGCGGGGGCGTGGAGGGTGTGG + Intronic
1142095600 16:88237778-88237800 TGGCGGGAGCAAGGAGGGCAGGG - Intergenic
1142696567 17:1637059-1637081 TGGCCTGAGGGAGGAGGGTAGGG + Exonic
1142861316 17:2763759-2763781 TGGAGAGCGGGAGGAGGGGAGGG + Intergenic
1143258263 17:5579914-5579936 TGAAGAGTGGGAGAAGGGTAAGG + Intronic
1143436722 17:6934152-6934174 TGGAGAGTGGGAGGAGGCTAAGG - Intronic
1143710545 17:8731755-8731777 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1143938262 17:10510032-10510054 TGGAGAGTGGGAGGAGGGAGGGG + Intronic
1144695669 17:17302439-17302461 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
1146602663 17:34232123-34232145 TGGAGAGTGAGAGGAGGGTGAGG + Intergenic
1147697708 17:42368885-42368907 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1148667962 17:49388738-49388760 TGGGGAGTGCGTGGAGGGGAGGG - Intronic
1151060706 17:71090559-71090581 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1151142470 17:72007054-72007076 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1151194924 17:72424631-72424653 CGGCCAGTGGGAGGAGGGGATGG - Intergenic
1151318262 17:73337196-73337218 TGGCCAGGGCGGGGAGGGGAAGG - Exonic
1152226339 17:79094548-79094570 GGGGGAGTGGGAGGAGGGTGGGG + Intronic
1154196851 18:12273161-12273183 TGGCCACGGCGAGGAGGGTTTGG + Intronic
1155773729 18:29732537-29732559 TGGCTTGTGGGAGGAGGGTGAGG - Intergenic
1155878759 18:31118358-31118380 GGAAGAGTGGGAGGAGGGTAAGG - Intergenic
1156076460 18:33284259-33284281 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1156168514 18:34453591-34453613 TGGAGAGTGGGAGGAGGTTGAGG + Intergenic
1156572579 18:38275023-38275045 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1156928484 18:42612241-42612263 TGGAGGGTGGGAGGAGGGTAAGG - Intergenic
1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG + Intronic
1158371781 18:56814642-56814664 TGGAGAGTGGTAGGATGGTAAGG + Intronic
1158688766 18:59641451-59641473 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1159465427 18:68776665-68776687 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1159532206 18:69669239-69669261 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1159788126 18:72740434-72740456 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1160319649 18:77878397-77878419 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1160696074 19:485081-485103 AGGGGAGTGAGAGGAGGGGAGGG + Intergenic
1161493722 19:4576316-4576338 GGGAGAGTGGGAGGAGGGAAGGG - Intergenic
1163034735 19:14564105-14564127 GGGCAGGTGGGAGGAGGGTAGGG + Intronic
1163045982 19:14642568-14642590 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1163059435 19:14748116-14748138 TGGAGAGTGGGAGGAGGGCGAGG - Intronic
1163632005 19:18422293-18422315 TGGGGAGTGGGAGGACAGTATGG - Intronic
1164854913 19:31513216-31513238 TGGGGTGTGGGAGGAGGGAAGGG - Intergenic
1165773339 19:38390491-38390513 TGGGGCATGCGGGGAGGGTAGGG + Intronic
1166457161 19:42951439-42951461 TGGTGAGTGTGGGGAGGGAAGGG + Intronic
1166473239 19:43098382-43098404 TGGTGAGTGTGGGGAGGGAAGGG + Intronic
1166494030 19:43285380-43285402 TGGTGAGTGAGGGGAGGGAAGGG + Intergenic
1167095608 19:47373541-47373563 TGGCCAGTGCGGGGAGGGAGGGG - Intronic
1168011601 19:53537772-53537794 GGGAGAGTGGGAGGAGGGAAAGG + Intronic
925385923 2:3461714-3461736 GGGCGGGTGGGAGGAGGGTGAGG - Intronic
926290238 2:11523233-11523255 TGGAGAGTGGGAGGAGGGGGAGG + Intergenic
926835457 2:17014347-17014369 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
928056003 2:28055267-28055289 TGGAGGGTGAGAGGAGGGTGAGG + Intronic
929135646 2:38621434-38621456 TGAAGAGTGGGAGGAGGGTGAGG + Intergenic
929255310 2:39804511-39804533 TGGAGAATGGGAGGAGGGTGAGG - Intergenic
930147248 2:48019802-48019824 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
930462005 2:51693176-51693198 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
930583804 2:53246084-53246106 TGGAGAGTGGAAGGAGGGTGAGG + Intergenic
930669880 2:54137419-54137441 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
931015560 2:57975904-57975926 TGGAGGGTGAGAGGAGGGTGAGG - Intronic
931253741 2:60553767-60553789 TGGCCAGTGCGGGGAGGGGGAGG + Intergenic
931502174 2:62881245-62881267 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
931868108 2:66433327-66433349 TGGCGAGTGGGACGTGGGTGGGG + Intergenic
932667767 2:73710728-73710750 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
932852859 2:75203273-75203295 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
933101578 2:78265649-78265671 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
933629945 2:84644578-84644600 TGGGGAGTGGGAGGAGGGAGAGG - Intronic
935345351 2:102103001-102103023 TGGAGTGTGGGAGGAGGGTGAGG + Intronic
935459797 2:103316939-103316961 TGGAGAGTGGGAAGAGGCTAAGG - Intergenic
935519748 2:104090034-104090056 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
936960036 2:118063253-118063275 TGAAGAGTGGGAGGAGGGTGAGG - Intergenic
938323503 2:130381487-130381509 TGGTGACTGCCAAGAGGGTATGG - Intergenic
938866702 2:135429388-135429410 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
941519745 2:166525777-166525799 AGGAGAGTGGGAGGAGGGAAGGG + Intergenic
941539790 2:166768048-166768070 TGGAGTGTGGGAGGAGGGTGTGG - Intergenic
941980855 2:171455118-171455140 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
941993631 2:171580658-171580680 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
942159093 2:173163263-173163285 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
942523983 2:176833359-176833381 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
943148943 2:184084879-184084901 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
943456080 2:188108852-188108874 TGGAGAGTAGGAGGAGGGTGAGG + Intergenic
944277857 2:197860012-197860034 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
945085339 2:206125795-206125817 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
945216196 2:207436599-207436621 GGGCGAGTGAAAGGAGGGCAAGG + Intergenic
945462177 2:210121500-210121522 TGGAGGGTGCGAGGAGGGAGAGG + Intronic
945519205 2:210802227-210802249 TGGAGGGTGTGAGGAGGGTGAGG - Intergenic
945639423 2:212404787-212404809 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
945807877 2:214512408-214512430 TGGGGAGTGGGAGGAGGGAGAGG + Intronic
946159091 2:217825309-217825331 TGGCTAGAGGGAGGTGGGTAGGG - Intronic
946598286 2:221331020-221331042 TGGAGAGTGGGAGGAAGGTAAGG + Intergenic
948043460 2:234923850-234923872 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
948077838 2:235180184-235180206 TGGAGGGTGGGAGGAGGGCAAGG - Intergenic
1168749791 20:274328-274350 TGGTGAGTGTGAGGAGAGGAAGG + Intronic
1169024633 20:2358844-2358866 TGGAGGGTGGGAGGAGGGTTAGG - Intergenic
1169173441 20:3486298-3486320 TGGCTGGTGGGAGGAGGGGAAGG - Intronic
1169177311 20:3528591-3528613 TGGAGAGTGGGAGGAGAGTAAGG + Intronic
1169378156 20:5083994-5084016 TGGAGAGTGGGAGGAGGGTGAGG - Intronic
1169849441 20:10033944-10033966 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1170282290 20:14663333-14663355 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1171147631 20:22799434-22799456 CAGCGAGTGAGAAGAGGGTATGG + Intergenic
1173037652 20:39428097-39428119 TGGGGAGTGCGTGGAGGGGGAGG - Intergenic
1173966270 20:47115172-47115194 TGGCAGGTGGGAGAAGGGTAAGG - Intronic
1174311212 20:49656163-49656185 TGGCAGGTGAGAGGAGGGCAGGG - Intronic
1174652492 20:52139505-52139527 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1174711419 20:52709599-52709621 TGGAGAGTGGGAGGAGGGAGGGG + Intergenic
1174926796 20:54769228-54769250 TGGAGAGTGGGAGAAGGGAAAGG - Intergenic
1177309540 21:19371828-19371850 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1177523545 21:22263400-22263422 TGGAGTGTGGGAGGAGGGGAAGG + Intergenic
1179537419 21:42061526-42061548 TGGGTGGTGGGAGGAGGGTATGG - Intergenic
1179543688 21:42100725-42100747 TGGGGAGGGTGAGGAGGGCACGG - Intronic
1179543702 21:42100759-42100781 TGGGGAGGGTGAGGAGGGCATGG - Intronic
1179543730 21:42100827-42100849 TGGGGAGGGTGAGGAGGGCACGG - Intronic
1179543745 21:42100861-42100883 TGGGGAGGGTGAGGAGGGCACGG - Intronic
1179543760 21:42100895-42100917 TGGGGAGGGTGAGGAGGGCACGG - Intronic
1182025926 22:27119190-27119212 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
1182067250 22:27439246-27439268 TGGTGAGTGACAGGAGGATATGG + Intergenic
1182750934 22:32641645-32641667 TGGGGTGTGGGAGGAGGGAAGGG + Intronic
1183034547 22:35131210-35131232 TGGGGAGTGCGGGGAGGGGGCGG + Intergenic
1183151928 22:36044521-36044543 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1185231042 22:49683014-49683036 TGGAGGGTGGGAGGAGGGCAAGG - Intergenic
949229757 3:1737019-1737041 TGGAGGGTGCGAGGAGGATGAGG - Intergenic
949995682 3:9614774-9614796 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
950848431 3:16038027-16038049 TGGAAAGTGGGAGGAGGGTGAGG - Intergenic
950947692 3:16966909-16966931 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
951284884 3:20798307-20798329 TGGAGAGTGGAAGGAGGGTGAGG - Intergenic
952693866 3:36242793-36242815 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
953165071 3:40457548-40457570 TGGCGAGCGCGTGGAGGGCCCGG + Intronic
954053186 3:47999700-47999722 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
954527810 3:51288449-51288471 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
954960294 3:54558555-54558577 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
954976751 3:54703082-54703104 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
955010530 3:55010238-55010260 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
955033122 3:55240215-55240237 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
955488491 3:59459107-59459129 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
956895891 3:73659432-73659454 TGGCAAATGCTAGGAGGGTATGG - Intergenic
957693155 3:83597699-83597721 TGGTGAGTGGGAGGAGGGAGTGG + Intergenic
957951323 3:87131154-87131176 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
958014355 3:87920728-87920750 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
958193270 3:90210421-90210443 GGGAGGGTGGGAGGAGGGTAGGG + Intergenic
958416575 3:93881365-93881387 GGGAGGGTGGGAGGAGGGTAGGG + Intronic
958463128 3:94424256-94424278 TGGAGGGTGGGAGGAGGATAAGG + Intergenic
958826192 3:99034375-99034397 TGGAGTGTGGGAGGAGGGTAAGG + Intergenic
959113160 3:102145749-102145771 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
959128239 3:102317603-102317625 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
959680364 3:109089065-109089087 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
960347387 3:116550903-116550925 TAGAGGGTGAGAGGAGGGTAAGG - Intronic
960745689 3:120885708-120885730 TGGCGAGTGGAAAGAAGGTAAGG - Intergenic
960766620 3:121137081-121137103 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
961341905 3:126229848-126229870 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
961850604 3:129813648-129813670 TGGAGAGTGGGAGGAGGGTGAGG + Intronic
961910642 3:130312739-130312761 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
962123536 3:132589852-132589874 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
962341609 3:134590091-134590113 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
962681542 3:137805458-137805480 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
962695453 3:137943261-137943283 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
963632096 3:147746237-147746259 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
963963120 3:151332881-151332903 TAGTGGGTGGGAGGAGGGTAAGG - Intronic
964141907 3:153412496-153412518 TGGAGAGTGGGAGGAGGGATAGG - Intergenic
964828507 3:160856658-160856680 TGGAGAGTGGGAGGAGGGTGAGG + Intronic
965065830 3:163847371-163847393 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
965725917 3:171715906-171715928 TGGGGGGTGGGAGGAGGGAAAGG - Intronic
965854154 3:173067446-173067468 TGGAGAATGGGAGGAGGGTAAGG + Intronic
966671774 3:182535313-182535335 TGGAGGGTGCGAGGAGGGAGAGG - Intergenic
967556944 3:190871010-190871032 TGGAGAGTGGGAGGAGGGAAAGG + Intronic
967593536 3:191304810-191304832 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
967619070 3:191610018-191610040 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
968250875 3:197212091-197212113 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
968259999 3:197313631-197313653 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
969782583 4:9420584-9420606 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
970726030 4:19045814-19045836 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
970783943 4:19773223-19773245 TGGCTAGTGTGAGGAAGGAATGG - Intergenic
971056487 4:22919217-22919239 TGGAGAGTGGGAGGAGGGGGAGG - Intergenic
971791329 4:31173619-31173641 TGGAGAGTGAGAGGAGGGGGAGG - Intergenic
972010662 4:34176985-34177007 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
972294179 4:37720729-37720751 TGGAGAATGGGAGGAGGGTGAGG + Intergenic
973091030 4:46136807-46136829 TGGAGGGTGGGAGGAGGGTTAGG + Intergenic
974738721 4:65976700-65976722 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
975494369 4:75021598-75021620 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
976825317 4:89254370-89254392 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
976851615 4:89553539-89553561 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
977519449 4:98062302-98062324 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
977697098 4:99977833-99977855 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
977903627 4:102451193-102451215 TGGAGGATGGGAGGAGGGTAAGG + Intergenic
978656663 4:111073658-111073680 TGGTGGGTGGGAGGAGGGTGAGG + Intergenic
978693796 4:111550452-111550474 TGGAGAGTAGGAGGAGGGTGAGG + Intergenic
980089591 4:128428566-128428588 TGGAGGGTGAGAGGAGGGTGAGG - Intergenic
981444786 4:144823126-144823148 TGGAGAGCGAGAGGAGGGTGAGG - Intergenic
981868262 4:149454469-149454491 TTGGGAGTGGGAGGAGGGTGAGG + Intergenic
981878290 4:149576289-149576311 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
982162328 4:152582829-152582851 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
982851736 4:160326014-160326036 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
983028598 4:162769928-162769950 TGGCGAGTGAGATGTGGGCAGGG + Intergenic
983145386 4:164207823-164207845 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
983268009 4:165528115-165528137 TGGATAGTGGGAGGAGGGTGAGG - Intergenic
983639449 4:169931133-169931155 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
983753217 4:171302127-171302149 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
983996428 4:174188232-174188254 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
984222461 4:176994714-176994736 TGGGGAGTGAGGGGAGGGGAGGG - Intergenic
984305239 4:177980989-177981011 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
984690878 4:182724729-182724751 TGGCGGGGGAGAAGAGGGTAAGG + Intronic
985245440 4:187975800-187975822 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
986011285 5:3718065-3718087 TGGAGAGTGGGAGGAGGGAGGGG - Intergenic
986228471 5:5839271-5839293 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
986481837 5:8197287-8197309 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
987394517 5:17409682-17409704 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
987599568 5:20049357-20049379 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
988336209 5:29911894-29911916 TGGAGGGTGAGAGGAGGGTGAGG + Intergenic
988960849 5:36370088-36370110 TGGAGAGTGGGAGGAGGATGAGG - Intergenic
988978836 5:36543408-36543430 TGGAGAATGGGAGGAGGGCAAGG - Intergenic
989339924 5:40362774-40362796 TGGAGGGTGGGAAGAGGGTAAGG - Intergenic
989448005 5:41553692-41553714 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
989824859 5:45840765-45840787 TAGAGAGTGGGAGGAGGGTGAGG - Intergenic
989964573 5:50452734-50452756 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
990336967 5:54783849-54783871 GGGAGAGTGGGAGGAGGGAAAGG + Intergenic
990885046 5:60581781-60581803 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
991521954 5:67509797-67509819 TGGAGAGTGGAAGGAGGGTAAGG + Intergenic
991958908 5:72022091-72022113 TGGAGAGTGGGAGGATGGTGAGG - Intergenic
992757278 5:79919731-79919753 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
993219701 5:85076400-85076422 TGGAGTGTGGGAGGAGGGAAAGG - Intergenic
993347058 5:86797480-86797502 TGGAGTGTGGGAGGAGGGAAAGG - Intergenic
993459193 5:88162168-88162190 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
993759938 5:91782475-91782497 TGGAGGGTGGGTGGAGGGTAAGG - Intergenic
994176582 5:96718395-96718417 TGGAGGGAGGGAGGAGGGTAAGG + Intronic
995188534 5:109296760-109296782 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
996979398 5:129471691-129471713 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
997181734 5:131836036-131836058 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
997358613 5:133280284-133280306 TGGCAAGTGGCAGGTGGGTATGG + Intronic
997900227 5:137756463-137756485 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
998619625 5:143779913-143779935 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
998631503 5:143903987-143904009 TGGGGGGTGGGAGGAGGGAAAGG - Intergenic
998647793 5:144082681-144082703 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
999071106 5:148744993-148745015 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
999761724 5:154706562-154706584 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
999982681 5:156972956-156972978 GGAAGAGTGGGAGGAGGGTAAGG - Intergenic
1000145953 5:158453489-158453511 TGGAGGGTTGGAGGAGGGTAAGG + Intergenic
1000521165 5:162296384-162296406 TGGAGGGTGGGAGGAGGGTAAGG - Intergenic
1001206273 5:169766208-169766230 TAGAGGGTGGGAGGAGGGTAAGG - Intronic
1002096316 5:176833290-176833312 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1002441041 5:179264673-179264695 TGGCGAGGCAGAGGAGGGAAAGG + Intronic
1003206387 6:4016567-4016589 AGGCCAGTGCGATGAGAGTAGGG - Intergenic
1003476712 6:6490374-6490396 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1004092798 6:12521970-12521992 TGGAGGGTGAGAGGAGGGTGAGG - Intergenic
1004118538 6:12795616-12795638 AGGAGAGGGCGAGAAGGGTATGG + Intronic
1004365813 6:15011658-15011680 TGGTGAGTGAGAGGAGGGAGAGG + Intergenic
1004586818 6:17010706-17010728 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1004764834 6:18714502-18714524 TGGGGAGTGGGAGGAGGGAGAGG - Intergenic
1004929621 6:20449758-20449780 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1006276614 6:33009428-33009450 GTGCGAGGGCGAGGAGGGTGCGG - Intronic
1006293744 6:33160567-33160589 TGGCGAAGGAGAGGAGGGTTTGG - Intergenic
1007093154 6:39196865-39196887 TGGAGAGTGCGAGGAGCGGTGGG + Intronic
1008285450 6:49643849-49643871 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1008779535 6:55086227-55086249 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1009505161 6:64468641-64468663 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1009621189 6:66079910-66079932 TGGAGAGTGGGAGGTGGGTGAGG - Intergenic
1009656480 6:66552577-66552599 TGGAGGGTGGGAGGAAGGTAAGG + Intergenic
1009729431 6:67580867-67580889 TGGAGGGTGTGAGGAGGGAAAGG - Intergenic
1009842179 6:69091644-69091666 TGGCGGGTGGGAGGAGGGAAAGG + Intronic
1010330352 6:74616436-74616458 TGGAGAGTGAGAGGAGGGAGAGG - Intergenic
1011179204 6:84600769-84600791 TGGAGTGTGGGAGGAGGGTGAGG - Intergenic
1011269441 6:85561985-85562007 TGGAGAGTGGGAGGAGGATTAGG - Intronic
1011628910 6:89305802-89305824 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1011970853 6:93220747-93220769 TGGAGGGTGGGAGGAGGATAAGG + Intergenic
1012356293 6:98318243-98318265 TGGAGAGTGGGAGGAGGGAAGGG - Intergenic
1012529248 6:100214409-100214431 GGGAGAGTAGGAGGAGGGTAAGG + Intergenic
1013195424 6:107840823-107840845 TGGAGAGTGGGACGGGGGTAAGG + Intergenic
1014244309 6:119050996-119051018 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1014778482 6:125537241-125537263 TGGCCAGTGAGATGGGGGTATGG - Intergenic
1015045551 6:128771512-128771534 TGGAGAGTGGGAGGAGGATGAGG + Intergenic
1016088946 6:139951586-139951608 TGGAGAGTGGGAGGAGGGTGAGG + Intergenic
1016368449 6:143343885-143343907 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1016480605 6:144476809-144476831 TGGATAGTTCGAGGAGGGTATGG + Intronic
1016616877 6:146060386-146060408 TGGAGAGTGGGAGGAGGGTGAGG - Intronic
1016923385 6:149317622-149317644 AGGCGAGCGCGAGGGGGGTGGGG + Intronic
1017400985 6:154061672-154061694 TGGAAGGTGGGAGGAGGGTAAGG + Intronic
1017928129 6:158928115-158928137 TGGAGAGTGGGAAGAGGGTGAGG - Intergenic
1017971492 6:159315806-159315828 GGGCGAGTGCGAGGAGGAGAAGG - Intergenic
1017991975 6:159497799-159497821 TGGAGAGTGAGAGGAGGGTGAGG + Intergenic
1018512243 6:164537581-164537603 TGGAGAGTGGGAAGAGGGTGAGG + Intergenic
1019646744 7:2134337-2134359 TGGTGAGAGAGAGCAGGGTATGG - Intronic
1019740015 7:2668087-2668109 TGGCTAGGGGGAGGGGGGTAGGG + Intergenic
1019817173 7:3209878-3209900 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1020606915 7:10350575-10350597 TGGAGGGTGCGAAGAGGGCAAGG - Intergenic
1020650995 7:10876103-10876125 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1020689343 7:11335472-11335494 TGGAAAGTGGGAGGAGGGAAAGG + Intergenic
1021336517 7:19409446-19409468 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1023785264 7:43701243-43701265 TGGAGAGTGGGAGGAGGGTGAGG - Intronic
1023791329 7:43755965-43755987 TGGAGAGTGGAAGGAGGGTTTGG - Intergenic
1024624544 7:51194090-51194112 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
1024885138 7:54132820-54132842 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1025271174 7:57518660-57518682 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1025584405 7:62764521-62764543 TTGGGAGTGCATGGAGGGTATGG - Intergenic
1026143496 7:67725948-67725970 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1026774868 7:73225151-73225173 TGGCTAGGGCCAGGAGGGTGGGG + Intergenic
1027015723 7:74778522-74778544 TGGCTAGGGCCAGGAGGGTGGGG + Intronic
1027072305 7:75167415-75167437 TGGCTAGGGCCAGGAGGGTGGGG - Intergenic
1027875356 7:83761610-83761632 TGGAGGGTGAGAGGAGGGTAAGG - Intergenic
1029012879 7:97281294-97281316 GGGCGAGTGGGTGGAGGGTGGGG - Intergenic
1029412364 7:100422717-100422739 TGGAGAGTGGGAGGAGGATGAGG - Intronic
1029891220 7:103932391-103932413 TGGAGAGTGGGAGGAGGGAGAGG + Intronic
1030164800 7:106543434-106543456 TTGTGAGTGTGAGGAGGGCAGGG - Intergenic
1030169710 7:106589001-106589023 TGGTGACGGCGAGGAGGGGAGGG - Intergenic
1031097580 7:117439863-117439885 TGGAGGGTGAGAGGAGGGTGAGG - Intergenic
1031289142 7:119910037-119910059 TGGAGAGTGCGAGCAGGGAGAGG - Intergenic
1031429281 7:121646775-121646797 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1031445818 7:121852320-121852342 TGGAGAGTGGGAGGAGGGAGCGG + Intergenic
1031714363 7:125089287-125089309 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1032586991 7:133156027-133156049 TGGAGGGTGGGAGGAGGGTAAGG + Intergenic
1032960944 7:137033348-137033370 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1033268008 7:139903082-139903104 GGGAGAGTGGGAGGAGGGTGAGG - Intronic
1033769058 7:144527962-144527984 AGGCGGGTGGGAGGAGGGTGAGG + Intronic
1034934682 7:155191252-155191274 TGGCAAGTGGGAGGAAGGGAAGG - Intergenic
1035817133 8:2553470-2553492 TGGAGAGTGGGAGAAGGGAAGGG - Intergenic
1035863090 8:3051448-3051470 TGGAGGGTGGGAGGAAGGTAAGG + Intronic
1036506061 8:9357395-9357417 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1036836481 8:12073542-12073564 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1036858322 8:12320111-12320133 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1037300934 8:17451352-17451374 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1037400691 8:18492559-18492581 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1037458851 8:19088975-19088997 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1037498444 8:19462961-19462983 TGGAGAGTAGGAGGAGGGTGAGG - Intronic
1037558740 8:20053515-20053537 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1039443850 8:37614566-37614588 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1040703785 8:50100920-50100942 TGGACAGTGGGAGGAGGGTGAGG - Intronic
1040883927 8:52238859-52238881 TGGGGGGTGGGAGGAGGGTGAGG + Intronic
1042464166 8:69107954-69107976 TGGAGGGTGGGAGGAGAGTAAGG - Intergenic
1042703991 8:71647401-71647423 TGGAAAGTGGGAGGAGGGTGAGG + Intergenic
1043095381 8:75962801-75962823 TGGCGAGTGGAAGGAAGGAAAGG + Intergenic
1045545913 8:103128144-103128166 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1046137046 8:110041104-110041126 TGGTGAGTGGAAGGAGGGTGAGG - Intergenic
1046165581 8:110430361-110430383 TGGAGGGTGAGAGGAGGGAAAGG - Intergenic
1046346988 8:112942715-112942737 TGGAGGGTGAGAGGAGGGTGAGG + Intronic
1046441668 8:114263098-114263120 GGGAGGGTGGGAGGAGGGTAGGG - Intergenic
1046596469 8:116267020-116267042 TGGAGGGTGAGAGGAGGGTGAGG - Intergenic
1046940324 8:119924876-119924898 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1046959615 8:120096510-120096532 TGGAGAGTAGGAGGAGGGTGAGG - Intronic
1046989503 8:120435354-120435376 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1047018805 8:120752826-120752848 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1047433283 8:124812023-124812045 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1047580406 8:126208242-126208264 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1048107858 8:131430958-131430980 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1048761383 8:137799263-137799285 TGGAGTGTGGGAGGAGGGTGAGG - Intergenic
1049009936 8:139880507-139880529 TGGGGAGTGCAGGGAGGGTCTGG - Intronic
1050070781 9:1811073-1811095 TGGAGAGCGGGAGGAGGGTGAGG + Intergenic
1050310093 9:4343920-4343942 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1050928068 9:11290883-11290905 TAGAGAGTGGGAGGAGGATAAGG - Intergenic
1051494610 9:17705805-17705827 TAGAGAGTGGGAGGAGGGTGAGG + Intronic
1051688817 9:19687133-19687155 TGGAGAATGAGAGGAGGGTGAGG + Intronic
1053010408 9:34629482-34629504 TGGGGTGTGCGTGGAGGGTCTGG + Intergenic
1053080082 9:35168385-35168407 TATGGAGTGGGAGGAGGGTAAGG - Intronic
1053615222 9:39758657-39758679 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1053873390 9:42517921-42517943 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1053899361 9:42777999-42778021 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1054238297 9:62583733-62583755 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1054262293 9:62879577-62879599 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1054268939 9:62948831-62948853 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1054552427 9:66618253-66618275 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1054960793 9:70966739-70966761 TGGAGGGTGGGAGGAGGGAAAGG + Intronic
1054975778 9:71143325-71143347 TGGGGAGTGGGAGGAGGGAGAGG - Intronic
1055217547 9:73884694-73884716 TGCCGAGTGCGAAGAGGGAGAGG - Intergenic
1055369894 9:75586229-75586251 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1055782752 9:79837183-79837205 TGGAGAGTAGGAGGAGGGTGAGG - Intergenic
1055874968 9:80931473-80931495 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1056111066 9:83395469-83395491 TGGAGAGTGGGAGGAGGGAGAGG - Intronic
1056122648 9:83504500-83504522 TGGCGAGTGTGAGGAATGTGAGG - Intronic
1057337361 9:94166369-94166391 CCGCGAGCGCGAGGTGGGTATGG + Intergenic
1057408045 9:94791344-94791366 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1057503193 9:95611881-95611903 TGGTGAGTTCGAGGAGGATGTGG + Intergenic
1057860994 9:98640690-98640712 TGGAGAGGAGGAGGAGGGTAAGG + Intronic
1059099731 9:111458631-111458653 TGGAGAGGGAGAGGAGGGTGGGG + Intronic
1059104875 9:111502342-111502364 TGGCGAGTGGGGGGTGGGTTGGG - Intergenic
1059375383 9:113876589-113876611 TGCGGGGTGCGAGGAGGGTGGGG + Intronic
1060044073 9:120326206-120326228 TGGGGAGGGAGAGGAGGTTAGGG - Intergenic
1061375937 9:130224611-130224633 TGGAGGGTGAGAGGAGGGTGAGG + Intronic
1061496144 9:130975530-130975552 TGGGGATTGGGAGGAGGGAAAGG + Intergenic
1061572391 9:131485802-131485824 TGGTGAGTGGGAGGTGGGAAGGG + Intronic
1061820923 9:133226815-133226837 TGGCCAGTGCCAGGAGGTGAAGG - Intergenic
1186018496 X:5226639-5226661 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1186234512 X:7493259-7493281 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1186310438 X:8311911-8311933 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1186786690 X:12962466-12962488 TGGAAAGTGAGAGTAGGGTAAGG - Intergenic
1186904967 X:14101051-14101073 TAGAGAGTGGGAGGAGGGTAAGG - Intergenic
1187054285 X:15727327-15727349 TGGAGGGTGGGAGGAGGGTGTGG - Intronic
1187242938 X:17530209-17530231 TGGAGAGGGAGAGGAGGGGAGGG - Intronic
1187607327 X:20899908-20899930 TGGAGAGTAGGAGGAGGGTGAGG - Intergenic
1187746432 X:22414231-22414253 TGGAGGGTGGGAGGAGGATAAGG + Intergenic
1187796631 X:23010950-23010972 TGGCGTGTGGGAGGAGGGAGAGG - Intergenic
1187945250 X:24420075-24420097 TGGAGAGTGAGAGGAGGGTGGGG - Intergenic
1188029675 X:25250502-25250524 TGGGGAGTTGGAGGAGGGTGAGG - Intergenic
1188035128 X:25308914-25308936 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1188072087 X:25729488-25729510 TGGAGAGTGGGAAGAGGGAAAGG + Intergenic
1188194881 X:27221432-27221454 TGGAGAGTGGGAGGAGGGTGAGG - Intergenic
1188228017 X:27625863-27625885 TGGAGGGTGGGAGGAGGGTGAGG + Intronic
1188247798 X:27855678-27855700 TGGCGGATCAGAGGAGGGTATGG + Intergenic
1189154369 X:38741754-38741776 TGGAGAGTGGCAGGAGGGTCAGG - Intergenic
1189652489 X:43205122-43205144 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1189659364 X:43279969-43279991 TGAAGCGTGGGAGGAGGGTAAGG - Intergenic
1189689560 X:43601772-43601794 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1189881509 X:45498290-45498312 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1189892996 X:45625022-45625044 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1189895605 X:45652744-45652766 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1189926767 X:45962874-45962896 TGGATAGTGAGAGGAGGGTGGGG + Intergenic
1190127529 X:47720034-47720056 TGGAGGGTGGGAGGAGGGTAAGG + Intergenic
1190809604 X:53870501-53870523 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1190880652 X:54490187-54490209 TGGAGGGAGGGAGGAGGGTAAGG + Intronic
1191651845 X:63547343-63547365 TGGAGGGTGAGAGGAGGGTAAGG + Intergenic
1192354817 X:70391756-70391778 TGGAGGGTGGGAGGAGGGTGAGG - Intronic
1193085153 X:77442378-77442400 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1193171022 X:78335897-78335919 TGGAGGGTGGGAGGAGGGAAAGG - Intergenic
1193289687 X:79757162-79757184 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1193429354 X:81382067-81382089 TGGAGGGTGAGAGGAGGGTTGGG - Intergenic
1193512770 X:82426159-82426181 TGGAGGGAGGGAGGAGGGTAAGG - Intergenic
1193774588 X:85626508-85626530 TGGAGTGTGGGAGGAGGGTGAGG + Intergenic
1194433181 X:93837135-93837157 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1194446717 X:93996627-93996649 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1194568111 X:95519355-95519377 TGGAGGGTGGGAGGAGGGAATGG + Intergenic
1194619115 X:96146723-96146745 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1194851058 X:98869819-98869841 TGGAGAGCGGGAGGAGGGTGAGG - Intergenic
1195353429 X:104015681-104015703 TGGAGAGTGGGAGGAGGGACAGG - Intergenic
1195483059 X:105370362-105370384 TGGAGGGTGGGAGGAGGGTTAGG - Intronic
1195557061 X:106238789-106238811 TGGGGGGTGGGAGGAGGGAAAGG + Intergenic
1195979728 X:110564368-110564390 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1196010263 X:110879529-110879551 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1196540753 X:116904085-116904107 TGAAAAGTGGGAGGAGGGTAAGG + Intergenic
1196556787 X:117097005-117097027 TGGAGAGTGGTAGGAGGGTGGGG + Intergenic
1196573966 X:117296930-117296952 TGAAGAGTGGGAGGAGGGTGAGG - Intergenic
1196830281 X:119770568-119770590 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1196896603 X:120343082-120343104 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1196994560 X:121367415-121367437 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1197408716 X:126088830-126088852 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1198733233 X:139756823-139756845 TGGAGAGTGAGAGGAGGGAGAGG + Intronic
1198837714 X:140821820-140821842 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1198937663 X:141915907-141915929 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1198957914 X:142152056-142152078 TGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1198961392 X:142186956-142186978 TGGAGAGTGGGAGGAGGGAGAGG + Intergenic
1199338464 X:146647196-146647218 TAGAGGGTGGGAGGAGGGTAAGG - Intergenic
1199462826 X:148102421-148102443 TGCAGAGTGAGAGGAGGGTGAGG + Intergenic
1199488815 X:148376723-148376745 TGGAGGGTGAGAGGAGGGAAAGG + Intergenic
1199492845 X:148420080-148420102 TGGAGGGTGGGAGGAGGGAAAGG + Intergenic
1199641298 X:149864789-149864811 TGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1199747916 X:150786360-150786382 TGGAGGGTGGGAGGAGGGAAAGG - Intronic
1199963999 X:152803280-152803302 TGGAGAGTGGGAGGAGGGAGAGG - Intergenic
1200361254 X:155609391-155609413 TGGAGATTGGGAGGAGGGTGAGG + Intronic
1201587218 Y:15574173-15574195 GGGAGGGTGCGAGGAGGTTAAGG + Intergenic