ID: 1074870198

View in Genome Browser
Species Human (GRCh38)
Location 10:117570130-117570152
Sequence GGGAGGGTACTGTTTGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074870198_1074870209 5 Left 1074870198 10:117570130-117570152 CCCTGTACAAACAGTACCCTCCC No data
Right 1074870209 10:117570158-117570180 GGCTTGGAGTCCTGGTGATTAGG No data
1074870198_1074870205 -3 Left 1074870198 10:117570130-117570152 CCCTGTACAAACAGTACCCTCCC No data
Right 1074870205 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
1074870198_1074870211 19 Left 1074870198 10:117570130-117570152 CCCTGTACAAACAGTACCCTCCC No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074870198 Original CRISPR GGGAGGGTACTGTTTGTACA GGG (reversed) Intergenic
No off target data available for this crispr