ID: 1074870204

View in Genome Browser
Species Human (GRCh38)
Location 10:117570150-117570172
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074870204_1074870214 22 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870214 10:117570195-117570217 CTGCAGAGAGCTCAGTGGGCTGG No data
1074870204_1074870213 18 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870213 10:117570191-117570213 CTGGCTGCAGAGAGCTCAGTGGG No data
1074870204_1074870212 17 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870204_1074870215 23 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870215 10:117570196-117570218 TGCAGAGAGCTCAGTGGGCTGGG No data
1074870204_1074870216 24 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870216 10:117570197-117570219 GCAGAGAGCTCAGTGGGCTGGGG No data
1074870204_1074870211 -1 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074870204 Original CRISPR CCAGGACTCCAAGCCAGGTG GGG (reversed) Intergenic