ID: 1074870210

View in Genome Browser
Species Human (GRCh38)
Location 10:117570168-117570190
Sequence CTCATTAAATCCTAATCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074870210_1074870215 5 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870215 10:117570196-117570218 TGCAGAGAGCTCAGTGGGCTGGG No data
1074870210_1074870217 19 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870217 10:117570210-117570232 TGGGCTGGGGTCAGTCTTCTAGG No data
1074870210_1074870216 6 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870216 10:117570197-117570219 GCAGAGAGCTCAGTGGGCTGGGG No data
1074870210_1074870212 -1 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870210_1074870213 0 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870213 10:117570191-117570213 CTGGCTGCAGAGAGCTCAGTGGG No data
1074870210_1074870218 26 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870218 10:117570217-117570239 GGGTCAGTCTTCTAGGCCTGCGG No data
1074870210_1074870214 4 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870214 10:117570195-117570217 CTGCAGAGAGCTCAGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074870210 Original CRISPR CTCATTAAATCCTAATCACC AGG (reversed) Intergenic
No off target data available for this crispr