ID: 1074870211

View in Genome Browser
Species Human (GRCh38)
Location 10:117570172-117570194
Sequence GTGATTAGGATTTAATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074870204_1074870211 -1 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870207_1074870211 -3 Left 1074870207 10:117570152-117570174 CCACCTGGCTTGGAGTCCTGGTG No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870203_1074870211 2 Left 1074870203 10:117570147-117570169 CCTCCCCACCTGGCTTGGAGTCC No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870198_1074870211 19 Left 1074870198 10:117570130-117570152 CCCTGTACAAACAGTACCCTCCC No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870206_1074870211 -2 Left 1074870206 10:117570151-117570173 CCCACCTGGCTTGGAGTCCTGGT No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870199_1074870211 18 Left 1074870199 10:117570131-117570153 CCTGTACAAACAGTACCCTCCCC No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870208_1074870211 -6 Left 1074870208 10:117570155-117570177 CCTGGCTTGGAGTCCTGGTGATT No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data
1074870202_1074870211 3 Left 1074870202 10:117570146-117570168 CCCTCCCCACCTGGCTTGGAGTC No data
Right 1074870211 10:117570172-117570194 GTGATTAGGATTTAATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074870211 Original CRISPR GTGATTAGGATTTAATGAGC TGG Intergenic
No off target data available for this crispr