ID: 1074870212

View in Genome Browser
Species Human (GRCh38)
Location 10:117570190-117570212
Sequence GCTGGCTGCAGAGAGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074870202_1074870212 21 Left 1074870202 10:117570146-117570168 CCCTCCCCACCTGGCTTGGAGTC No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870210_1074870212 -1 Left 1074870210 10:117570168-117570190 CCTGGTGATTAGGATTTAATGAG No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870206_1074870212 16 Left 1074870206 10:117570151-117570173 CCCACCTGGCTTGGAGTCCTGGT No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870208_1074870212 12 Left 1074870208 10:117570155-117570177 CCTGGCTTGGAGTCCTGGTGATT No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870204_1074870212 17 Left 1074870204 10:117570150-117570172 CCCCACCTGGCTTGGAGTCCTGG No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870203_1074870212 20 Left 1074870203 10:117570147-117570169 CCTCCCCACCTGGCTTGGAGTCC No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data
1074870207_1074870212 15 Left 1074870207 10:117570152-117570174 CCACCTGGCTTGGAGTCCTGGTG No data
Right 1074870212 10:117570190-117570212 GCTGGCTGCAGAGAGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074870212 Original CRISPR GCTGGCTGCAGAGAGCTCAG TGG Intergenic
No off target data available for this crispr