ID: 1074874698

View in Genome Browser
Species Human (GRCh38)
Location 10:117604643-117604665
Sequence GACTAGCCTTTGGTGCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074874692_1074874698 3 Left 1074874692 10:117604617-117604639 CCAAATGTTCAGTTGAGAATGGA No data
Right 1074874698 10:117604643-117604665 GACTAGCCTTTGGTGCCTCCGGG No data
1074874690_1074874698 10 Left 1074874690 10:117604610-117604632 CCTGATGCCAAATGTTCAGTTGA No data
Right 1074874698 10:117604643-117604665 GACTAGCCTTTGGTGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074874698 Original CRISPR GACTAGCCTTTGGTGCCTCC GGG Intergenic
No off target data available for this crispr