ID: 1074877568

View in Genome Browser
Species Human (GRCh38)
Location 10:117626076-117626098
Sequence CTCCTCGCACCACTCTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074877568_1074877580 10 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877580 10:117626109-117626131 GCTGCAGGAGATGGGGAAGTGGG No data
1074877568_1074877579 9 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877579 10:117626108-117626130 TGCTGCAGGAGATGGGGAAGTGG No data
1074877568_1074877578 3 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877578 10:117626102-117626124 AGGGGGTGCTGCAGGAGATGGGG No data
1074877568_1074877581 15 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877581 10:117626114-117626136 AGGAGATGGGGAAGTGGGAGAGG No data
1074877568_1074877586 28 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877586 10:117626127-117626149 GTGGGAGAGGGGAGGGTGAAAGG No data
1074877568_1074877576 1 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877576 10:117626100-117626122 GCAGGGGGTGCTGCAGGAGATGG No data
1074877568_1074877582 16 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877582 10:117626115-117626137 GGAGATGGGGAAGTGGGAGAGGG No data
1074877568_1074877577 2 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877577 10:117626101-117626123 CAGGGGGTGCTGCAGGAGATGGG No data
1074877568_1074877585 21 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877585 10:117626120-117626142 TGGGGAAGTGGGAGAGGGGAGGG No data
1074877568_1074877583 17 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877583 10:117626116-117626138 GAGATGGGGAAGTGGGAGAGGGG No data
1074877568_1074877575 -5 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877575 10:117626094-117626116 AGGAGGGCAGGGGGTGCTGCAGG No data
1074877568_1074877584 20 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877584 10:117626119-117626141 ATGGGGAAGTGGGAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074877568 Original CRISPR CTCCTCGCACCACTCTCTCT AGG (reversed) Intergenic
No off target data available for this crispr