ID: 1074877577

View in Genome Browser
Species Human (GRCh38)
Location 10:117626101-117626123
Sequence CAGGGGGTGCTGCAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074877568_1074877577 2 Left 1074877568 10:117626076-117626098 CCTAGAGAGAGTGGTGCGAGGAG No data
Right 1074877577 10:117626101-117626123 CAGGGGGTGCTGCAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074877577 Original CRISPR CAGGGGGTGCTGCAGGAGAT GGG Intergenic
No off target data available for this crispr