ID: 1074882405

View in Genome Browser
Species Human (GRCh38)
Location 10:117669224-117669246
Sequence TTCCCAGCTCCCATGCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074882405_1074882413 14 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882413 10:117669261-117669283 GTACCTGAGCTGCAAATGTCTGG No data
1074882405_1074882416 24 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data
1074882405_1074882409 -8 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882409 10:117669239-117669261 GCTGGGAACCCCAGGAGGGCTGG No data
1074882405_1074882415 19 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074882405 Original CRISPR TTCCCAGCTCCCATGCACCT CGG (reversed) Intergenic
No off target data available for this crispr