ID: 1074882410

View in Genome Browser
Species Human (GRCh38)
Location 10:117669247-117669269
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074882410_1074882416 1 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data
1074882410_1074882421 29 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882410_1074882415 -4 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882410_1074882413 -9 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882413 10:117669261-117669283 GTACCTGAGCTGCAAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074882410 Original CRISPR CTCAGGTACCAGCCCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr