ID: 1074882415

View in Genome Browser
Species Human (GRCh38)
Location 10:117669266-117669288
Sequence TGAGCTGCAAATGTCTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074882412_1074882415 -6 Left 1074882412 10:117669249-117669271 CCAGGAGGGCTGGTACCTGAGCT No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882401_1074882415 28 Left 1074882401 10:117669215-117669237 CCAGCTCAGCCGAGGTGCATGGG No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882411_1074882415 -5 Left 1074882411 10:117669248-117669270 CCCAGGAGGGCTGGTACCTGAGC No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882399_1074882415 29 Left 1074882399 10:117669214-117669236 CCCAGCTCAGCCGAGGTGCATGG No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882410_1074882415 -4 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data
1074882405_1074882415 19 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882415 10:117669266-117669288 TGAGCTGCAAATGTCTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074882415 Original CRISPR TGAGCTGCAAATGTCTGGCC CGG Intergenic
No off target data available for this crispr