ID: 1074882416

View in Genome Browser
Species Human (GRCh38)
Location 10:117669271-117669293
Sequence TGCAAATGTCTGGCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074882405_1074882416 24 Left 1074882405 10:117669224-117669246 CCGAGGTGCATGGGAGCTGGGAA No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data
1074882411_1074882416 0 Left 1074882411 10:117669248-117669270 CCCAGGAGGGCTGGTACCTGAGC No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data
1074882410_1074882416 1 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data
1074882412_1074882416 -1 Left 1074882412 10:117669249-117669271 CCAGGAGGGCTGGTACCTGAGCT No data
Right 1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074882416 Original CRISPR TGCAAATGTCTGGCCCGGCC TGG Intergenic
No off target data available for this crispr