ID: 1074882421

View in Genome Browser
Species Human (GRCh38)
Location 10:117669299-117669321
Sequence CTCAGCACATGTGATGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074882412_1074882421 27 Left 1074882412 10:117669249-117669271 CCAGGAGGGCTGGTACCTGAGCT No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882410_1074882421 29 Left 1074882410 10:117669247-117669269 CCCCAGGAGGGCTGGTACCTGAG No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882411_1074882421 28 Left 1074882411 10:117669248-117669270 CCCAGGAGGGCTGGTACCTGAGC No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882418_1074882421 -9 Left 1074882418 10:117669285-117669307 CCGGCCTGGCCTCTCTCAGCACA No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882417_1074882421 -8 Left 1074882417 10:117669284-117669306 CCCGGCCTGGCCTCTCTCAGCAC No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data
1074882414_1074882421 12 Left 1074882414 10:117669264-117669286 CCTGAGCTGCAAATGTCTGGCCC No data
Right 1074882421 10:117669299-117669321 CTCAGCACATGTGATGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074882421 Original CRISPR CTCAGCACATGTGATGCATT AGG Intergenic
No off target data available for this crispr