ID: 1074883384

View in Genome Browser
Species Human (GRCh38)
Location 10:117675931-117675953
Sequence CTGGGGGTAGGGAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074883384_1074883397 25 Left 1074883384 10:117675931-117675953 CCTTCTCTCCTCCCTACCCCCAG No data
Right 1074883397 10:117675979-117676001 TACTAAAGAGCAATATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074883384 Original CRISPR CTGGGGGTAGGGAGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr