ID: 1074885913

View in Genome Browser
Species Human (GRCh38)
Location 10:117693536-117693558
Sequence CCATGGCCAATGTGGGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074885913_1074885923 28 Left 1074885913 10:117693536-117693558 CCAATAGCCCACATTGGCCATGG No data
Right 1074885923 10:117693587-117693609 CTATCAACACTGCGTCCTGGAGG No data
1074885913_1074885922 25 Left 1074885913 10:117693536-117693558 CCAATAGCCCACATTGGCCATGG No data
Right 1074885922 10:117693584-117693606 GTGCTATCAACACTGCGTCCTGG No data
1074885913_1074885921 -3 Left 1074885913 10:117693536-117693558 CCAATAGCCCACATTGGCCATGG No data
Right 1074885921 10:117693556-117693578 TGGTCGGGGATAAATGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074885913 Original CRISPR CCATGGCCAATGTGGGCTAT TGG (reversed) Intergenic
No off target data available for this crispr