ID: 1074885970

View in Genome Browser
Species Human (GRCh38)
Location 10:117693910-117693932
Sequence CAGAATTCCCAGGATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074885970_1074885986 28 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885986 10:117693961-117693983 GAATGTTCCAGTGGATGGTGGGG No data
1074885970_1074885987 29 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885987 10:117693962-117693984 AATGTTCCAGTGGATGGTGGGGG No data
1074885970_1074885979 6 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885979 10:117693939-117693961 ACCCATAGGGAGATGGTTCAGGG No data
1074885970_1074885985 27 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885985 10:117693960-117693982 GGAATGTTCCAGTGGATGGTGGG No data
1074885970_1074885982 19 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885982 10:117693952-117693974 TGGTTCAGGGAATGTTCCAGTGG No data
1074885970_1074885984 26 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885984 10:117693959-117693981 GGGAATGTTCCAGTGGATGGTGG No data
1074885970_1074885978 5 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885978 10:117693938-117693960 GACCCATAGGGAGATGGTTCAGG No data
1074885970_1074885975 -8 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885975 10:117693925-117693947 GAATTCTGGAGCTGACCCATAGG No data
1074885970_1074885976 -7 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885976 10:117693926-117693948 AATTCTGGAGCTGACCCATAGGG No data
1074885970_1074885977 -1 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885977 10:117693932-117693954 GGAGCTGACCCATAGGGAGATGG No data
1074885970_1074885983 23 Left 1074885970 10:117693910-117693932 CCCACCTCATCCTGGGAATTCTG No data
Right 1074885983 10:117693956-117693978 TCAGGGAATGTTCCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074885970 Original CRISPR CAGAATTCCCAGGATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr