ID: 1074886743

View in Genome Browser
Species Human (GRCh38)
Location 10:117699957-117699979
Sequence GCAATCTGTTATGGCAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074886738_1074886743 22 Left 1074886738 10:117699912-117699934 CCATGAGAGAATAAAGTCCTATT No data
Right 1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG No data
1074886739_1074886743 5 Left 1074886739 10:117699929-117699951 CCTATTGTTTTAAGCCACTCAGT No data
Right 1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG No data
1074886741_1074886743 -9 Left 1074886741 10:117699943-117699965 CCACTCAGTGTGTGGCAATCTGT No data
Right 1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074886743 Original CRISPR GCAATCTGTTATGGCAACCC TGG Intergenic
No off target data available for this crispr