ID: 1074890848

View in Genome Browser
Species Human (GRCh38)
Location 10:117735562-117735584
Sequence AAGTACAAGGGGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074890848_1074890862 28 Left 1074890848 10:117735562-117735584 CCTGACCACTTCCCCTTGTACTT No data
Right 1074890862 10:117735613-117735635 CCCATGGGAAATATGTTCTCGGG No data
1074890848_1074890860 27 Left 1074890848 10:117735562-117735584 CCTGACCACTTCCCCTTGTACTT No data
Right 1074890860 10:117735612-117735634 GCCCATGGGAAATATGTTCTCGG No data
1074890848_1074890857 13 Left 1074890848 10:117735562-117735584 CCTGACCACTTCCCCTTGTACTT No data
Right 1074890857 10:117735598-117735620 AACTCCTTCCTGAGGCCCATGGG No data
1074890848_1074890854 5 Left 1074890848 10:117735562-117735584 CCTGACCACTTCCCCTTGTACTT No data
Right 1074890854 10:117735590-117735612 AAAATCCAAACTCCTTCCTGAGG No data
1074890848_1074890856 12 Left 1074890848 10:117735562-117735584 CCTGACCACTTCCCCTTGTACTT No data
Right 1074890856 10:117735597-117735619 AAACTCCTTCCTGAGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074890848 Original CRISPR AAGTACAAGGGGAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr