ID: 1074890876

View in Genome Browser
Species Human (GRCh38)
Location 10:117735701-117735723
Sequence CCAAGTCACCATTTAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074890876_1074890879 0 Left 1074890876 10:117735701-117735723 CCTGTCCTTAAATGGTGACTTGG No data
Right 1074890879 10:117735724-117735746 AGCAGATTCCTTAACCTCTCTGG No data
1074890876_1074890886 27 Left 1074890876 10:117735701-117735723 CCTGTCCTTAAATGGTGACTTGG No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890876_1074890882 18 Left 1074890876 10:117735701-117735723 CCTGTCCTTAAATGGTGACTTGG No data
Right 1074890882 10:117735742-117735764 TCTGGCCTCCCAGCTGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074890876 Original CRISPR CCAAGTCACCATTTAAGGAC AGG (reversed) Intergenic
No off target data available for this crispr