ID: 1074890881

View in Genome Browser
Species Human (GRCh38)
Location 10:117735738-117735760
Sequence TTACAGCTGGGAGGCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074890881_1074890888 7 Left 1074890881 10:117735738-117735760 CCTCTCTGGCCTCCCAGCTGTAA No data
Right 1074890888 10:117735768-117735790 TAACGGAACCCCACCTTCAAGGG No data
1074890881_1074890886 -10 Left 1074890881 10:117735738-117735760 CCTCTCTGGCCTCCCAGCTGTAA No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890881_1074890887 6 Left 1074890881 10:117735738-117735760 CCTCTCTGGCCTCCCAGCTGTAA No data
Right 1074890887 10:117735767-117735789 TTAACGGAACCCCACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074890881 Original CRISPR TTACAGCTGGGAGGCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr