ID: 1074890886

View in Genome Browser
Species Human (GRCh38)
Location 10:117735751-117735773
Sequence CCAGCTGTAAATGGAGTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074890878_1074890886 22 Left 1074890878 10:117735706-117735728 CCTTAAATGGTGACTTGGAGCAG No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890881_1074890886 -10 Left 1074890881 10:117735738-117735760 CCTCTCTGGCCTCCCAGCTGTAA No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890876_1074890886 27 Left 1074890876 10:117735701-117735723 CCTGTCCTTAAATGGTGACTTGG No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890880_1074890886 -4 Left 1074890880 10:117735732-117735754 CCTTAACCTCTCTGGCCTCCCAG No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data
1074890875_1074890886 28 Left 1074890875 10:117735700-117735722 CCCTGTCCTTAAATGGTGACTTG No data
Right 1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074890886 Original CRISPR CCAGCTGTAAATGGAGTTAA CGG Intergenic
No off target data available for this crispr