ID: 1074891046

View in Genome Browser
Species Human (GRCh38)
Location 10:117736870-117736892
Sequence GCGGAATGAGGGAGTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074891034_1074891046 20 Left 1074891034 10:117736827-117736849 CCAGAGCCAGCTGCTTTAGACTG No data
Right 1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG No data
1074891033_1074891046 21 Left 1074891033 10:117736826-117736848 CCCAGAGCCAGCTGCTTTAGACT No data
Right 1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG No data
1074891032_1074891046 22 Left 1074891032 10:117736825-117736847 CCCCAGAGCCAGCTGCTTTAGAC No data
Right 1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG No data
1074891040_1074891046 -6 Left 1074891040 10:117736853-117736875 CCTGCTAGGCTTGCCAGGCGGAA No data
Right 1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG No data
1074891036_1074891046 14 Left 1074891036 10:117736833-117736855 CCAGCTGCTTTAGACTGGCTCCT No data
Right 1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074891046 Original CRISPR GCGGAATGAGGGAGTCTGAG GGG Intergenic
No off target data available for this crispr