ID: 1074892062

View in Genome Browser
Species Human (GRCh38)
Location 10:117744041-117744063
Sequence CAGTGGTTCCATCAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074892062_1074892073 11 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892073 10:117744075-117744097 CCTCTAAATAGAATGGGGGTTGG No data
1074892062_1074892071 7 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892071 10:117744071-117744093 ACAGCCTCTAAATAGAATGGGGG No data
1074892062_1074892075 13 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892075 10:117744077-117744099 TCTAAATAGAATGGGGGTTGGGG No data
1074892062_1074892069 5 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892069 10:117744069-117744091 AGACAGCCTCTAAATAGAATGGG No data
1074892062_1074892076 29 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892076 10:117744093-117744115 GTTGGGGAGAACCTTTAAAGAGG No data
1074892062_1074892068 4 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892068 10:117744068-117744090 AAGACAGCCTCTAAATAGAATGG No data
1074892062_1074892070 6 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892070 10:117744070-117744092 GACAGCCTCTAAATAGAATGGGG No data
1074892062_1074892074 12 Left 1074892062 10:117744041-117744063 CCCACCTACTGATGGAACCACTG No data
Right 1074892074 10:117744076-117744098 CTCTAAATAGAATGGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074892062 Original CRISPR CAGTGGTTCCATCAGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr