ID: 1074892209

View in Genome Browser
Species Human (GRCh38)
Location 10:117745025-117745047
Sequence CCTTATTGGCAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074892203_1074892209 19 Left 1074892203 10:117744983-117745005 CCTTAATTTAAGGAAAAGATATA No data
Right 1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074892209 Original CRISPR CCTTATTGGCAAAATGAGGA TGG Intergenic
No off target data available for this crispr