ID: 1074893831

View in Genome Browser
Species Human (GRCh38)
Location 10:117757668-117757690
Sequence ATGCATTTGGTCCAAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074893824_1074893831 11 Left 1074893824 10:117757634-117757656 CCTTGGCATGCCTCCAACACATT No data
Right 1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG No data
1074893827_1074893831 -2 Left 1074893827 10:117757647-117757669 CCAACACATTTGGTCTCGACCAT No data
Right 1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG No data
1074893823_1074893831 12 Left 1074893823 10:117757633-117757655 CCCTTGGCATGCCTCCAACACAT No data
Right 1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG No data
1074893826_1074893831 1 Left 1074893826 10:117757644-117757666 CCTCCAACACATTTGGTCTCGAC No data
Right 1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074893831 Original CRISPR ATGCATTTGGTCCAAAGTGT GGG Intergenic
No off target data available for this crispr