ID: 1074896877

View in Genome Browser
Species Human (GRCh38)
Location 10:117784748-117784770
Sequence CGCCGGCTGTCCTTGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074896877_1074896883 0 Left 1074896877 10:117784748-117784770 CCCACACTCAAGGACAGCCGGCG No data
Right 1074896883 10:117784771-117784793 GCTCAGAAGGCCACCTGTTTGGG No data
1074896877_1074896882 -1 Left 1074896877 10:117784748-117784770 CCCACACTCAAGGACAGCCGGCG No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074896877 Original CRISPR CGCCGGCTGTCCTTGAGTGT GGG (reversed) Intergenic
No off target data available for this crispr