ID: 1074896882

View in Genome Browser
Species Human (GRCh38)
Location 10:117784770-117784792
Sequence GGCTCAGAAGGCCACCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074896877_1074896882 -1 Left 1074896877 10:117784748-117784770 CCCACACTCAAGGACAGCCGGCG No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896870_1074896882 22 Left 1074896870 10:117784725-117784747 CCAGCTGCCCGGCTCAGGCCTTC No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896876_1074896882 0 Left 1074896876 10:117784747-117784769 CCCCACACTCAAGGACAGCCGGC No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896874_1074896882 4 Left 1074896874 10:117784743-117784765 CCTTCCCCACACTCAAGGACAGC No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896878_1074896882 -2 Left 1074896878 10:117784749-117784771 CCACACTCAAGGACAGCCGGCGG No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896872_1074896882 14 Left 1074896872 10:117784733-117784755 CCGGCTCAGGCCTTCCCCACACT No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896869_1074896882 23 Left 1074896869 10:117784724-117784746 CCCAGCTGCCCGGCTCAGGCCTT No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data
1074896871_1074896882 15 Left 1074896871 10:117784732-117784754 CCCGGCTCAGGCCTTCCCCACAC No data
Right 1074896882 10:117784770-117784792 GGCTCAGAAGGCCACCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074896882 Original CRISPR GGCTCAGAAGGCCACCTGTT TGG Intergenic
No off target data available for this crispr