ID: 1074898369

View in Genome Browser
Species Human (GRCh38)
Location 10:117796094-117796116
Sequence GACCCACTTGGAGGGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074898369_1074898375 27 Left 1074898369 10:117796094-117796116 CCTGTCTTCCCTCCAAGTGGGTC No data
Right 1074898375 10:117796144-117796166 AAACTTAGCTAACCAGTTTATGG No data
1074898369_1074898373 -8 Left 1074898369 10:117796094-117796116 CCTGTCTTCCCTCCAAGTGGGTC No data
Right 1074898373 10:117796109-117796131 AGTGGGTCCAACAAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074898369 Original CRISPR GACCCACTTGGAGGGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr