ID: 1074903414

View in Genome Browser
Species Human (GRCh38)
Location 10:117839302-117839324
Sequence ACCGATGGGGAGCCAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074903414_1074903428 29 Left 1074903414 10:117839302-117839324 CCCCCTCCTGGCTCCCCATCGGT No data
Right 1074903428 10:117839354-117839376 TAAACCAGAAAGCCTAAATTTGG No data
1074903414_1074903423 -5 Left 1074903414 10:117839302-117839324 CCCCCTCCTGGCTCCCCATCGGT No data
Right 1074903423 10:117839320-117839342 TCGGTGTACTGCGGTTACCCTGG No data
1074903414_1074903424 6 Left 1074903414 10:117839302-117839324 CCCCCTCCTGGCTCCCCATCGGT No data
Right 1074903424 10:117839331-117839353 CGGTTACCCTGGCCATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074903414 Original CRISPR ACCGATGGGGAGCCAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr