ID: 1074906010

View in Genome Browser
Species Human (GRCh38)
Location 10:117864507-117864529
Sequence AAAAGGTCCTTTAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074906006_1074906010 28 Left 1074906006 10:117864456-117864478 CCTGGCCAAAATTTTAAGTGGCT No data
Right 1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG No data
1074906007_1074906010 23 Left 1074906007 10:117864461-117864483 CCAAAATTTTAAGTGGCTTCTTG No data
Right 1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074906010 Original CRISPR AAAAGGTCCTTTAAGTGTCC AGG Intergenic
No off target data available for this crispr