ID: 1074910015

View in Genome Browser
Species Human (GRCh38)
Location 10:117899928-117899950
Sequence CTATTGAATGGGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074910015_1074910026 30 Left 1074910015 10:117899928-117899950 CCTTCCATCTTCCCATTCAATAG No data
Right 1074910026 10:117899981-117900003 AGCCAAAATCTCATTGACCGTGG No data
1074910015_1074910022 -5 Left 1074910015 10:117899928-117899950 CCTTCCATCTTCCCATTCAATAG No data
Right 1074910022 10:117899946-117899968 AATAGGAGACAGGGAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074910015 Original CRISPR CTATTGAATGGGAAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr