ID: 1074912563

View in Genome Browser
Species Human (GRCh38)
Location 10:117924757-117924779
Sequence CTGAGCCCCAGTTGCTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074912559_1074912563 -1 Left 1074912559 10:117924735-117924757 CCTCAGAGGTGCCCCAGCAGGGC No data
Right 1074912563 10:117924757-117924779 CTGAGCCCCAGTTGCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074912563 Original CRISPR CTGAGCCCCAGTTGCTCATG TGG Intergenic
No off target data available for this crispr