ID: 1074916814

View in Genome Browser
Species Human (GRCh38)
Location 10:117964700-117964722
Sequence CTGAGCGAGCACTGAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074916814_1074916818 21 Left 1074916814 10:117964700-117964722 CCTCTCACTCAGTGCTCGCTCAG No data
Right 1074916818 10:117964744-117964766 CTCTCTGAGCACAGACTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074916814 Original CRISPR CTGAGCGAGCACTGAGTGAG AGG (reversed) Intergenic