ID: 1074916818 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:117964744-117964766 |
| Sequence | CTCTCTGAGCACAGACTCAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074916816_1074916818 | -7 | Left | 1074916816 | 10:117964728-117964750 | CCTATGGTGTTGCCAACTCTCTG | No data | ||
| Right | 1074916818 | 10:117964744-117964766 | CTCTCTGAGCACAGACTCATTGG | No data | ||||
| 1074916814_1074916818 | 21 | Left | 1074916814 | 10:117964700-117964722 | CCTCTCACTCAGTGCTCGCTCAG | No data | ||
| Right | 1074916818 | 10:117964744-117964766 | CTCTCTGAGCACAGACTCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074916818 | Original CRISPR | CTCTCTGAGCACAGACTCAT TGG | Intergenic | ||