ID: 1074917666

View in Genome Browser
Species Human (GRCh38)
Location 10:117972770-117972792
Sequence CCACAGAACCAGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074917666_1074917668 -9 Left 1074917666 10:117972770-117972792 CCTTCTGCTCTCTGGTTCTGTGG No data
Right 1074917668 10:117972784-117972806 GTTCTGTGGCTAAAATCCAACGG No data
1074917666_1074917671 8 Left 1074917666 10:117972770-117972792 CCTTCTGCTCTCTGGTTCTGTGG No data
Right 1074917671 10:117972801-117972823 CAACGGTCAACTATGGATGAAGG No data
1074917666_1074917672 9 Left 1074917666 10:117972770-117972792 CCTTCTGCTCTCTGGTTCTGTGG No data
Right 1074917672 10:117972802-117972824 AACGGTCAACTATGGATGAAGGG No data
1074917666_1074917669 1 Left 1074917666 10:117972770-117972792 CCTTCTGCTCTCTGGTTCTGTGG No data
Right 1074917669 10:117972794-117972816 TAAAATCCAACGGTCAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074917666 Original CRISPR CCACAGAACCAGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr