ID: 1074919602

View in Genome Browser
Species Human (GRCh38)
Location 10:117993571-117993593
Sequence CAGAGATGGTGGCGCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074919590_1074919602 27 Left 1074919590 10:117993521-117993543 CCCCAGGATATGTAAGGGGCGGG No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data
1074919596_1074919602 -8 Left 1074919596 10:117993556-117993578 CCAGAAACCAGAGCACAGAGATG No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data
1074919593_1074919602 25 Left 1074919593 10:117993523-117993545 CCAGGATATGTAAGGGGCGGGTC No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data
1074919592_1074919602 26 Left 1074919592 10:117993522-117993544 CCCAGGATATGTAAGGGGCGGGT No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data
1074919587_1074919602 29 Left 1074919587 10:117993519-117993541 CCCCCCAGGATATGTAAGGGGCG No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data
1074919588_1074919602 28 Left 1074919588 10:117993520-117993542 CCCCCAGGATATGTAAGGGGCGG No data
Right 1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074919602 Original CRISPR CAGAGATGGTGGCGCCAGAG GGG Intergenic
No off target data available for this crispr