ID: 1074923631

View in Genome Browser
Species Human (GRCh38)
Location 10:118046209-118046231
Sequence ATTAGGCTCTCCCTCCGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074923631_1074923642 28 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923642 10:118046260-118046282 TAACGGAAACAGGCAGGCTCAGG 0: 1
1: 1
2: 0
3: 5
4: 109
1074923631_1074923643 29 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923643 10:118046261-118046283 AACGGAAACAGGCAGGCTCAGGG 0: 1
1: 0
2: 4
3: 9
4: 162
1074923631_1074923641 22 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923641 10:118046254-118046276 GACACTTAACGGAAACAGGCAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1074923631_1074923640 18 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923640 10:118046250-118046272 TAAGGACACTTAACGGAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1074923631_1074923638 11 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923638 10:118046243-118046265 TGCATCCTAAGGACACTTAACGG 0: 1
1: 0
2: 0
3: 6
4: 85
1074923631_1074923636 0 Left 1074923631 10:118046209-118046231 CCCTCCCGGAGGGAGAGCCTAAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1074923636 10:118046232-118046254 TCCTTAATCACTGCATCCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074923631 Original CRISPR ATTAGGCTCTCCCTCCGGGA GGG (reversed) Exonic
907621934 1:55990460-55990482 ATCAGGCTCTACTTCTGGGAGGG - Intergenic
907689711 1:56650411-56650433 TTTAGGCTCTCACTCTGGGTAGG + Intronic
910927408 1:92411040-92411062 ATTAGGATCTCCTGCTGGGAAGG - Intergenic
911749259 1:101477505-101477527 ATTAGGCTCTCCTTCTTGAAGGG + Intergenic
912927919 1:113929766-113929788 AGGAGGCTCCCCCTGCGGGACGG + Exonic
917534450 1:175864272-175864294 ATAAGGCTTCCCCTCCAGGAGGG + Intergenic
919819651 1:201465140-201465162 AGTAAGTTCTCCCTCCTGGAGGG - Intergenic
919924149 1:202183607-202183629 ATGAGGCTCTCCCTCCAGCTGGG - Intergenic
1065816548 10:29487953-29487975 AATATCCTCTCCCTCCAGGAGGG - Intronic
1065956317 10:30696702-30696724 AATATCCTCTCCCTCCAGGAGGG + Intergenic
1067869189 10:49941755-49941777 ATGAGGCTCTCCGCCCGGGCCGG - Exonic
1074923631 10:118046209-118046231 ATTAGGCTCTCCCTCCGGGAGGG - Exonic
1076878544 10:133229244-133229266 ATTAGGCCCCACCTCCTGGAGGG - Intergenic
1078728286 11:13952551-13952573 ATTAGGCTCTACCTCTTGAAGGG + Intergenic
1079675660 11:23223120-23223142 CTTAGGCTCACCTTCCAGGATGG - Intergenic
1085464456 11:76714491-76714513 CTTAGGATCTCCCTGAGGGAGGG + Intergenic
1089750568 11:120648402-120648424 CTCAGGCCCTCCCTCAGGGAAGG - Intronic
1091972128 12:4796434-4796456 ACCAGGCTCTTCCTCCGGGCAGG - Intronic
1096598794 12:52714830-52714852 ATTGGGTTCTTTCTCCGGGAAGG - Intergenic
1097057261 12:56257688-56257710 AGTAGGCTTTCACTCCAGGATGG + Intronic
1097278653 12:57830578-57830600 ATTAGGCTCCCCATCCTTGAGGG - Intronic
1097342183 12:58451512-58451534 ATTAGCCACTCCCCCCAGGAAGG - Intergenic
1097464350 12:59903946-59903968 ATTAGCCTGTCCCCCAGGGAAGG - Intergenic
1102599675 12:114020229-114020251 ATTAAGCTCCACCTCCTGGATGG + Intergenic
1104664114 12:130635269-130635291 ATTAGACTGTCACTCCAGGAGGG + Intronic
1107323311 13:39212167-39212189 ATAAGGCTCTGCATCCAGGAAGG - Intergenic
1111009591 13:82293800-82293822 ATAAGCCTCTCCTTCAGGGAAGG + Intergenic
1117984218 14:61371812-61371834 ATTATGCTCTACCTCCCTGAGGG + Intronic
1121979784 14:98444569-98444591 ATTGAGCTCTCTCTCTGGGAGGG - Intergenic
1122396784 14:101439108-101439130 ATTAAGTTCTCCCTCCAGCAAGG - Intergenic
1124559408 15:30757884-30757906 ATTCAGCTCTCCCTCCACGATGG + Intronic
1124671840 15:31647837-31647859 ATTCAGCTCTCCCTCCACGATGG - Intronic
1127582863 15:60353618-60353640 ATTAGGCTCTTCCTTTGGAAGGG - Intronic
1128913890 15:71542319-71542341 ATTAAGATCTCCTTCCTGGAGGG - Intronic
1131110097 15:89759539-89759561 CTTAGGACCTCCCTCCAGGATGG - Intergenic
1135121373 16:19769267-19769289 ATTAAGCTCTACCTTAGGGAGGG + Intronic
1138452595 16:57102542-57102564 TCTAGGCTCTCCCTCCAGGCTGG - Intronic
1141891357 16:86928800-86928822 ATTAGCCACTCCTTCCGGAAAGG + Intergenic
1143284132 17:5776627-5776649 AATAGACTCTGCCTCCTGGAGGG + Intronic
1147329083 17:39685950-39685972 GTTGGGCTCTACCTCCAGGAAGG - Exonic
1158749427 18:60241786-60241808 AGTAGGCTTTCTCTCTGGGATGG - Intergenic
1162507748 19:11096849-11096871 ATTAGGCTCTGCCTTCTGAAAGG + Intronic
1164858035 19:31540199-31540221 AATAGGCACTCCCTGAGGGAAGG - Intergenic
928708709 2:33980413-33980435 ATTAGGAGCTCCTTCAGGGAAGG + Intergenic
936276001 2:111097888-111097910 ATTAAGCTTTACCTCCTGGAGGG - Intronic
945028067 2:205638112-205638134 CTTAGGTTCTCCCTCAGGGGAGG - Intergenic
947828985 2:233125587-233125609 AGGAGGCTCTCCCTCCAGGAGGG + Intronic
948698938 2:239748581-239748603 ATTTGGCTCTGCCTGGGGGAGGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1171105441 20:22428743-22428765 ATAAGGTTCTCCCTCTGAGATGG + Intergenic
1171202762 20:23255213-23255235 ATTAAGCTCCCCCTCCTTGAGGG - Intergenic
1174556372 20:51398283-51398305 ATGAGGCTCTCCATCCGTGGTGG - Intronic
1174569575 20:51492148-51492170 ATGAGGCTCTCCCTCCTGCTGGG - Intronic
1180219708 21:46350772-46350794 TCCAGGCTCTCCCTCCGAGATGG + Intronic
1183600753 22:38839132-38839154 ATTTGGCTCCCACTCCAGGATGG + Intronic
949343040 3:3050074-3050096 ATTAGGCTCACCCTCACAGATGG - Intronic
955941337 3:64149475-64149497 AGCAGGCTCTCCCCACGGGAAGG - Intronic
959894685 3:111593102-111593124 ATTAAGCTCTGCTTCCGGCAGGG + Exonic
963153605 3:142072891-142072913 GTTATGCTCTCCCTCCTTGAGGG - Intronic
965144931 3:164889489-164889511 ATTAGGCACTGGCTCCTGGATGG - Intergenic
973836771 4:54817830-54817852 CTTAGGATCTCCCTCTGGGGAGG + Intergenic
978132410 4:105214580-105214602 ATTAGAATCTCCCTCAGGGTTGG - Intronic
981005756 4:139873464-139873486 ATTAGGTTCTCCCTTCTGAAGGG - Intronic
981848255 4:149195116-149195138 TTCAGGCTCTCCCTCAGAGAGGG - Intergenic
986454685 5:7904453-7904475 ATTAAGCTCCACCTCCTGGAGGG + Intronic
987257046 5:16165885-16165907 ATTGAGCTCTACCTCCTGGAGGG + Intronic
989467685 5:41775897-41775919 ATTAAGCTCTACCTCTTGGAGGG - Intronic
993540647 5:89146576-89146598 ATTAGGCTCTACCTCCTGAAGGG + Intergenic
998018520 5:138751903-138751925 ACTAGGCACTCCCTAGGGGATGG + Intronic
1007767684 6:44170693-44170715 ATTAGGCTCTACCTTTGGAAGGG + Intronic
1013994144 6:116287644-116287666 AATAGGTTTTCCCTCTGGGAAGG + Intronic
1017407511 6:154136063-154136085 ATTCGGCTCTGCCTCCAGGAAGG + Intronic
1017615890 6:156246037-156246059 ATTAAACTCTACCTCCTGGAGGG - Intergenic
1018162191 6:161055900-161055922 ATTAATCTCTACCTCCTGGAAGG + Intronic
1019377144 7:698930-698952 TTCAGCCTCTCCCTCCTGGAGGG + Intronic
1029237345 7:99131998-99132020 CTTAGCCTCTCCCTCAGGGCTGG - Intronic
1034489210 7:151384175-151384197 ATTTGGCTCTGCCTCTGGGAGGG - Intronic
1035724308 8:1815018-1815040 TCTAGGCTCTCCAGCCGGGAAGG + Intergenic
1041089460 8:54288503-54288525 ATCAGGCTTTCCCTCCCTGAGGG - Intergenic
1043474131 8:80589916-80589938 ATTAGCCCCTTCTTCCGGGAGGG - Intergenic
1045825771 8:106396183-106396205 ATTAAGCTCCACCTCCTGGAGGG - Intronic
1050802206 9:9629577-9629599 AATAGGCTGTCCCTCAGGGCTGG - Intronic
1051749707 9:20328358-20328380 ATTTGTCTTTCCCTCAGGGATGG - Intergenic
1057074801 9:92132843-92132865 ATGAGGCTCTCCCTCCAGCTGGG - Intergenic
1192302565 X:69920867-69920889 ATTAGGCTCCACCTCCTTGATGG + Intronic