ID: 1074923712

View in Genome Browser
Species Human (GRCh38)
Location 10:118046485-118046507
Sequence ACCCGGGCGGAGGGCTGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 631}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074923695_1074923712 15 Left 1074923695 10:118046447-118046469 CCCCAGGCCTGCGGGGCACGTGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923694_1074923712 19 Left 1074923694 10:118046443-118046465 CCTTCCCCAGGCCTGCGGGGCAC 0: 1
1: 0
2: 4
3: 40
4: 382
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923689_1074923712 29 Left 1074923689 10:118046433-118046455 CCTGTCTCCACCTTCCCCAGGCC 0: 1
1: 0
2: 10
3: 95
4: 815
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923704_1074923712 -10 Left 1074923704 10:118046472-118046494 CCTGGCCACACGGACCCGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923699_1074923712 8 Left 1074923699 10:118046454-118046476 CCTGCGGGGCACGTGAGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 273
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923696_1074923712 14 Left 1074923696 10:118046448-118046470 CCCAGGCCTGCGGGGCACGTGAG 0: 1
1: 0
2: 1
3: 38
4: 1067
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923688_1074923712 30 Left 1074923688 10:118046432-118046454 CCCTGTCTCCACCTTCCCCAGGC 0: 1
1: 0
2: 6
3: 71
4: 698
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923692_1074923712 22 Left 1074923692 10:118046440-118046462 CCACCTTCCCCAGGCCTGCGGGG 0: 1
1: 0
2: 9
3: 72
4: 490
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631
1074923697_1074923712 13 Left 1074923697 10:118046449-118046471 CCAGGCCTGCGGGGCACGTGAGG 0: 1
1: 0
2: 4
3: 15
4: 235
Right 1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 33
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074923712 Original CRISPR ACCCGGGCGGAGGGCTGCGG GGG Exonic